RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0324083524:

Variant ID: vg0324083524 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24083524
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGTATGTTTACGTGGCGTTCCCAAGAAAATAGTGTCAGACAGAGGTAGTCAGTATACTTCGAAGTTTTGGCAGAAGTTACAAGAAGAGATGGGTACTC[G/A]
TTTGAATTTCAGTACTGCCTATAACCCTCAAACTGATGGTCAGACAGAAAGAGTGAATCAAATTTTACAAGACATGGTTAGAGCCTGTGTCCTAGATTTC

Reverse complement sequence

GAAATCTAGGACACAGGCTCTAACCATGTCTTGTAAAATTTGATTCACTCTTTCTGTCTGACCATCAGTTTGAGGGTTATAGGCAGTACTGAAATTCAAA[C/T]
GAGTACCCATCTCTTCTTGTAACTTCTGCCAAAACTTCGAAGTATACTGACTACCTCTGTCTGACACTATTTTCTTGGGAACGCCACGTAAACATACAAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	3.20%	1.63%	0.00%	NA
All Indica	2759	99.70%	0.20%	0.14%	0.00%	NA
All Japonica	1512	85.70%	9.50%	4.83%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	73.00%	18.50%	8.47%	0.00%	NA
Tropical Japonica	504	99.20%	0.00%	0.79%	0.00%	NA
Japonica Intermediate	241	97.90%	0.40%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324083524	G -> A	LOC_Os03g43169.1	upstream_gene_variant ; 524.0bp to feature; MODIFIER	silent_mutation	Average:9.681; most accessible tissue: Callus, score: 43.517	N	N	N	N
vg0324083524	G -> A	LOC_Os03g43160.1	downstream_gene_variant ; 699.0bp to feature; MODIFIER	silent_mutation	Average:9.681; most accessible tissue: Callus, score: 43.517	N	N	N	N
vg0324083524	G -> A	LOC_Os03g43180.1	downstream_gene_variant ; 1549.0bp to feature; MODIFIER	silent_mutation	Average:9.681; most accessible tissue: Callus, score: 43.517	N	N	N	N
vg0324083524	G -> A	LOC_Os03g43190.1	downstream_gene_variant ; 3555.0bp to feature; MODIFIER	silent_mutation	Average:9.681; most accessible tissue: Callus, score: 43.517	N	N	N	N
vg0324083524	G -> A	LOC_Os03g43160-LOC_Os03g43169	intergenic_region ; MODIFIER	silent_mutation	Average:9.681; most accessible tissue: Callus, score: 43.517	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324083524	4.37E-06	NA	mr1570	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324083524	2.45E-06	1.41E-07	mr1570	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0324083524:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact