\
| Variant ID: vg0324076908 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 24076908 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGTTTTGTTGATTTCGTTCATTTGCTTTAGTTTCTGACGTTCCGGAGGAGAGCGTTTACATTGAGGAAGGTTCAGAGGTGTTTGAAGAATCTCAAGGCAA[T/G]
TCACACAGATTCCAAACAACCCTTTGAGCATGTTGGACCCGTTTAAAGCTAATGTTTTATTTCAACTTATGCATTATTTTCGAATGTCATCGGGTGGTGA
TCACCACCCGATGACATTCGAAAATAATGCATAAGTTGAAATAAAACATTAGCTTTAAACGGGTCCAACATGCTCAAAGGGTTGTTTGGAATCTGTGTGA[A/C]
TTGCCTTGAGATTCTTCAAACACCTCTGAACCTTCCTCAATGTAAACGCTCTCCTCCGGAACGTCAGAAACTAAAGCAAATGAACGAAATCAACAAAACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.10% | 2.30% | 1.33% | 56.26% | NA |
| All Indica | 2759 | 5.80% | 0.40% | 2.17% | 91.70% | NA |
| All Japonica | 1512 | 99.20% | 0.00% | 0.00% | 0.79% | NA |
| Aus | 269 | 42.40% | 36.10% | 0.37% | 21.19% | NA |
| Indica I | 595 | 7.20% | 0.20% | 1.34% | 91.26% | NA |
| Indica II | 465 | 2.60% | 0.90% | 1.94% | 94.62% | NA |
| Indica III | 913 | 3.60% | 0.00% | 2.08% | 94.30% | NA |
| Indica Intermediate | 786 | 9.00% | 0.60% | 3.05% | 87.28% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 78.10% | 0.00% | 1.04% | 20.83% | NA |
| Intermediate | 90 | 51.10% | 3.30% | 1.11% | 44.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324076908 | T -> DEL | N | N | silent_mutation | Average:7.628; most accessible tissue: Callus, score: 17.552 | N | N | N | N |
| vg0324076908 | T -> G | LOC_Os03g43150.1 | upstream_gene_variant ; 265.0bp to feature; MODIFIER | silent_mutation | Average:7.628; most accessible tissue: Callus, score: 17.552 | N | N | N | N |
| vg0324076908 | T -> G | LOC_Os03g43160.1 | upstream_gene_variant ; 2382.0bp to feature; MODIFIER | silent_mutation | Average:7.628; most accessible tissue: Callus, score: 17.552 | N | N | N | N |
| vg0324076908 | T -> G | LOC_Os03g43150-LOC_Os03g43160 | intergenic_region ; MODIFIER | silent_mutation | Average:7.628; most accessible tissue: Callus, score: 17.552 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324076908 | NA | 6.31E-06 | mr1434 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324076908 | NA | 8.75E-11 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324076908 | 1.60E-07 | NA | mr1681 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324076908 | 3.91E-10 | 3.91E-10 | mr1681 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324076908 | NA | 2.11E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324076908 | 1.56E-06 | 1.56E-06 | mr1779 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324076908 | NA | 1.74E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |