\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324076908:

Variant ID: vg0324076908 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24076908
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTTGTTGATTTCGTTCATTTGCTTTAGTTTCTGACGTTCCGGAGGAGAGCGTTTACATTGAGGAAGGTTCAGAGGTGTTTGAAGAATCTCAAGGCAA[T/G]
TCACACAGATTCCAAACAACCCTTTGAGCATGTTGGACCCGTTTAAAGCTAATGTTTTATTTCAACTTATGCATTATTTTCGAATGTCATCGGGTGGTGA

Reverse complement sequence

TCACCACCCGATGACATTCGAAAATAATGCATAAGTTGAAATAAAACATTAGCTTTAAACGGGTCCAACATGCTCAAAGGGTTGTTTGGAATCTGTGTGA[A/C]
TTGCCTTGAGATTCTTCAAACACCTCTGAACCTTCCTCAATGTAAACGCTCTCCTCCGGAACGTCAGAAACTAAAGCAAATGAACGAAATCAACAAAACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 2.30% 1.33% 56.26% NA
All Indica  2759 5.80% 0.40% 2.17% 91.70% NA
All Japonica  1512 99.20% 0.00% 0.00% 0.79% NA
Aus  269 42.40% 36.10% 0.37% 21.19% NA
Indica I  595 7.20% 0.20% 1.34% 91.26% NA
Indica II  465 2.60% 0.90% 1.94% 94.62% NA
Indica III  913 3.60% 0.00% 2.08% 94.30% NA
Indica Intermediate  786 9.00% 0.60% 3.05% 87.28% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 99.00% 0.00% 0.00% 0.99% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 78.10% 0.00% 1.04% 20.83% NA
Intermediate  90 51.10% 3.30% 1.11% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324076908 T -> DEL N N silent_mutation Average:7.628; most accessible tissue: Callus, score: 17.552 N N N N
vg0324076908 T -> G LOC_Os03g43150.1 upstream_gene_variant ; 265.0bp to feature; MODIFIER silent_mutation Average:7.628; most accessible tissue: Callus, score: 17.552 N N N N
vg0324076908 T -> G LOC_Os03g43160.1 upstream_gene_variant ; 2382.0bp to feature; MODIFIER silent_mutation Average:7.628; most accessible tissue: Callus, score: 17.552 N N N N
vg0324076908 T -> G LOC_Os03g43150-LOC_Os03g43160 intergenic_region ; MODIFIER silent_mutation Average:7.628; most accessible tissue: Callus, score: 17.552 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324076908 NA 6.31E-06 mr1434 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908 NA 8.75E-11 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908 1.60E-07 NA mr1681 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908 3.91E-10 3.91E-10 mr1681 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908 NA 2.11E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908 1.56E-06 1.56E-06 mr1779 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324076908 NA 1.74E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251