\
| Variant ID: vg0324021677 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 24021677 |
| Reference Allele: AAT | Alternative Allele: A,TAT |
| Primary Allele: A | Secondary Allele: AAT |
Inferred Ancestral Allele: Not determined.
TGCATTGGCAAGCATTCCACTTTTTCTTCAGGGCAATCTGATTATTTGACGAAATAAAGAAATGATATACAATGTTATGGTAGTATTATAATCGAAAAAA[AAT/A,TAT]
AATTCTGGCAGGCACGCTCCAACCAAACATGAACTTTTTGGTCGGTACCATACATGTACACAATGTACACAATGTCATGTACAATTAAATTAAGATAATT
AATTATCTTAATTTAATTGTACATGACATTGTGTACATTGTGTACATGTATGGTACCGACCAAAAAGTTCATGTTTGGTTGGAGCGTGCCTGCCAGAATT[ATT/T,ATA]
TTTTTTCGATTATAATACTACCATAACATTGTATATCATTTCTTTATTTCGTCAAATAATCAGATTGCCCTGAAGAAAAAGTGGAATGCTTGCCAATGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of AAT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 24.00% | 1.46% | 0.00% | TAT: 17.94% |
| All Indica | 2759 | 93.80% | 4.20% | 0.76% | 0.00% | TAT: 1.23% |
| All Japonica | 1512 | 0.80% | 45.00% | 2.71% | 0.00% | TAT: 51.46% |
| Aus | 269 | 11.50% | 81.80% | 1.12% | 0.00% | TAT: 5.58% |
| Indica I | 595 | 85.50% | 12.10% | 2.18% | 0.00% | TAT: 0.17% |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 0.80% | 0.00% | 0.00% | TAT: 0.77% |
| Indica Intermediate | 786 | 92.00% | 3.70% | 1.02% | 0.00% | TAT: 3.31% |
| Temperate Japonica | 767 | 0.50% | 64.50% | 4.04% | 0.00% | TAT: 30.90% |
| Tropical Japonica | 504 | 1.00% | 14.10% | 0.40% | 0.00% | TAT: 84.52% |
| Japonica Intermediate | 241 | 1.20% | 47.70% | 3.32% | 0.00% | TAT: 47.72% |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 27.80% | 4.44% | 0.00% | TAT: 23.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0324021677 | AAT -> TAT | LOC_Os03g43060.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.706; most accessible tissue: Callus, score: 61.751 | N | N | N | N |
| vg0324021677 | AAT -> A | LOC_Os03g43060.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.706; most accessible tissue: Callus, score: 61.751 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0324021677 | NA | 5.47E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324021677 | NA | 3.44E-06 | mr1425 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324021677 | NA | 4.76E-07 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324021677 | NA | 2.14E-18 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0324021677 | 3.94E-06 | 1.65E-07 | mr1991 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |