\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324021677:

Variant ID: vg0324021677 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 24021677
Reference Allele: AATAlternative Allele: A,TAT
Primary Allele: ASecondary Allele: AAT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCATTGGCAAGCATTCCACTTTTTCTTCAGGGCAATCTGATTATTTGACGAAATAAAGAAATGATATACAATGTTATGGTAGTATTATAATCGAAAAAA[AAT/A,TAT]
AATTCTGGCAGGCACGCTCCAACCAAACATGAACTTTTTGGTCGGTACCATACATGTACACAATGTACACAATGTCATGTACAATTAAATTAAGATAATT

Reverse complement sequence

AATTATCTTAATTTAATTGTACATGACATTGTGTACATTGTGTACATGTATGGTACCGACCAAAAAGTTCATGTTTGGTTGGAGCGTGCCTGCCAGAATT[ATT/T,ATA]
TTTTTTCGATTATAATACTACCATAACATTGTATATCATTTCTTTATTTCGTCAAATAATCAGATTGCCCTGAAGAAAAAGTGGAATGCTTGCCAATGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AAT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 24.00% 1.46% 0.00% TAT: 17.94%
All Indica  2759 93.80% 4.20% 0.76% 0.00% TAT: 1.23%
All Japonica  1512 0.80% 45.00% 2.71% 0.00% TAT: 51.46%
Aus  269 11.50% 81.80% 1.12% 0.00% TAT: 5.58%
Indica I  595 85.50% 12.10% 2.18% 0.00% TAT: 0.17%
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.50% 0.80% 0.00% 0.00% TAT: 0.77%
Indica Intermediate  786 92.00% 3.70% 1.02% 0.00% TAT: 3.31%
Temperate Japonica  767 0.50% 64.50% 4.04% 0.00% TAT: 30.90%
Tropical Japonica  504 1.00% 14.10% 0.40% 0.00% TAT: 84.52%
Japonica Intermediate  241 1.20% 47.70% 3.32% 0.00% TAT: 47.72%
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 44.40% 27.80% 4.44% 0.00% TAT: 23.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324021677 AAT -> TAT LOC_Os03g43060.1 intron_variant ; MODIFIER silent_mutation Average:48.706; most accessible tissue: Callus, score: 61.751 N N N N
vg0324021677 AAT -> A LOC_Os03g43060.1 intron_variant ; MODIFIER silent_mutation Average:48.706; most accessible tissue: Callus, score: 61.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324021677 NA 5.47E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324021677 NA 3.44E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324021677 NA 4.76E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324021677 NA 2.14E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324021677 3.94E-06 1.65E-07 mr1991 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251