\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0324014449:

Variant ID: vg0324014449 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 24014449
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


AATCATCATACCACAGAAAGCAGATAGCTTAGTAGACCAATTATTAGGCAATTGCATTCAGTACTTAAAGAACCAGCTTAAGGCCGGATAGTGCTACGCG[C/T]
TCTAAACAGGAAATAATTAAGCGGCTGAAGGCCGACACAACTAACGGCTTAAGGCCGAGCTAAGCTGAGTAGCTAACAGAAATAACGGCTTATGGCCGAG

Reverse complement sequence

CTCGGCCATAAGCCGTTATTTCTGTTAGCTACTCAGCTTAGCTCGGCCTTAAGCCGTTAGTTGTGTCGGCCTTCAGCCGCTTAATTATTTCCTGTTTAGA[G/A]
CGCGTAGCACTATCCGGCCTTAAGCTGGTTCTTTAAGTACTGAATGCAATTGCCTAATAATTGGTCTACTAAGCTATCTGCTTTCTGTGGTATGATGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 7.40% 0.17% 0.76% NA
All Indica  2759 92.10% 7.80% 0.04% 0.07% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 36.80% 48.30% 2.60% 12.27% NA
Indica I  595 75.10% 24.70% 0.17% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 92.70% 7.00% 0.00% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0324014449 C -> T LOC_Os03g43030.1 upstream_gene_variant ; 4328.0bp to feature; MODIFIER silent_mutation Average:74.329; most accessible tissue: Callus, score: 91.119 N N N N
vg0324014449 C -> T LOC_Os03g43040.1 downstream_gene_variant ; 627.0bp to feature; MODIFIER silent_mutation Average:74.329; most accessible tissue: Callus, score: 91.119 N N N N
vg0324014449 C -> T LOC_Os03g43050.1 downstream_gene_variant ; 341.0bp to feature; MODIFIER silent_mutation Average:74.329; most accessible tissue: Callus, score: 91.119 N N N N
vg0324014449 C -> T LOC_Os03g43060.1 downstream_gene_variant ; 4163.0bp to feature; MODIFIER silent_mutation Average:74.329; most accessible tissue: Callus, score: 91.119 N N N N
vg0324014449 C -> T LOC_Os03g43040-LOC_Os03g43050 intergenic_region ; MODIFIER silent_mutation Average:74.329; most accessible tissue: Callus, score: 91.119 N N N N
vg0324014449 C -> DEL N N silent_mutation Average:74.329; most accessible tissue: Callus, score: 91.119 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0324014449 NA 1.62E-07 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0324014449 NA 1.02E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 2.37E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 6.63E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 2.81E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 2.61E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 5.09E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 3.65E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 2.36E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 6.60E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 4.26E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 1.87E-06 6.53E-10 mr1681 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 1.36E-06 1.36E-06 mr1681 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 7.24E-06 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 3.94E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449 NA 3.09E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251