Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0324014449:

Variant ID: vg0324014449 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 24014449
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

AATCATCATACCACAGAAAGCAGATAGCTTAGTAGACCAATTATTAGGCAATTGCATTCAGTACTTAAAGAACCAGCTTAAGGCCGGATAGTGCTACGCG[C/T]
TCTAAACAGGAAATAATTAAGCGGCTGAAGGCCGACACAACTAACGGCTTAAGGCCGAGCTAAGCTGAGTAGCTAACAGAAATAACGGCTTATGGCCGAG

Reverse complement sequence

CTCGGCCATAAGCCGTTATTTCTGTTAGCTACTCAGCTTAGCTCGGCCTTAAGCCGTTAGTTGTGTCGGCCTTCAGCCGCTTAATTATTTCCTGTTTAGA[G/A]
CGCGTAGCACTATCCGGCCTTAAGCTGGTTCTTTAAGTACTGAATGCAATTGCCTAATAATTGGTCTACTAAGCTATCTGCTTTCTGTGGTATGATGATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	7.40%	0.17%	0.76%	NA
All Indica	2759	92.10%	7.80%	0.04%	0.07%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	36.80%	48.30%	2.60%	12.27%	NA
Indica I	595	75.10%	24.70%	0.17%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	92.70%	7.00%	0.00%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0324014449	C -> T	LOC_Os03g43030.1	upstream_gene_variant ; 4328.0bp to feature; MODIFIER	silent_mutation	Average:74.329; most accessible tissue: Callus, score: 91.119	N	N	N	N
vg0324014449	C -> T	LOC_Os03g43040.1	downstream_gene_variant ; 627.0bp to feature; MODIFIER	silent_mutation	Average:74.329; most accessible tissue: Callus, score: 91.119	N	N	N	N
vg0324014449	C -> T	LOC_Os03g43050.1	downstream_gene_variant ; 341.0bp to feature; MODIFIER	silent_mutation	Average:74.329; most accessible tissue: Callus, score: 91.119	N	N	N	N
vg0324014449	C -> T	LOC_Os03g43060.1	downstream_gene_variant ; 4163.0bp to feature; MODIFIER	silent_mutation	Average:74.329; most accessible tissue: Callus, score: 91.119	N	N	N	N
vg0324014449	C -> T	LOC_Os03g43040-LOC_Os03g43050	intergenic_region ; MODIFIER	silent_mutation	Average:74.329; most accessible tissue: Callus, score: 91.119	N	N	N	N
vg0324014449	C -> DEL	N	N	silent_mutation	Average:74.329; most accessible tissue: Callus, score: 91.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0324014449	NA	1.62E-07	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0324014449	NA	1.02E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	2.37E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	6.63E-11	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	2.81E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	2.61E-06	mr1434	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	5.09E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	3.65E-07	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	2.36E-06	mr1569	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	6.60E-09	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	4.26E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	1.87E-06	6.53E-10	mr1681	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	1.36E-06	1.36E-06	mr1681	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	7.24E-06	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	3.94E-07	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0324014449	NA	3.09E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251