\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323987975:

Variant ID: vg0323987975 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 23987975
Reference Allele: AAlternative Allele: T,AT
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, AT: 0.02, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATACTATTATGGTACCAATGTGTACCAGGATGCTTGCTACCACGGAATATATATGGTGTAATGTTCATTTCATAAGCAATTTAAAGTTCATCTTTTT[A/T,AT]
AAAAAAAAACACGACACAAACATAGACGCTCATAAAGCGCACGCATACTCACCCCCTAAGCATCTCTAACTAGACCAACATATCGATTGACGAAATCACT

Reverse complement sequence

AGTGATTTCGTCAATCGATATGTTGGTCTAGTTAGAGATGCTTAGGGGGTGAGTATGCGTGCGCTTTATGAGCGTCTATGTTTGTGTCGTGTTTTTTTTT[T/A,AT]
AAAAAGATGAACTTTAAATTGCTTATGAAATGAACATTACACCATATATATTCCGTGGTAGCAAGCATCCTGGTACACATTGGTACCATAATAGTATAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 18.60% 1.86% 4.85% AT: 0.02%
All Indica  2759 98.30% 1.20% 0.18% 0.40% NA
All Japonica  1512 45.20% 50.30% 4.50% 0.00% NA
Aus  269 11.90% 6.70% 2.23% 79.18% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.30% 0.00% 0.43% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 2.20% 0.64% 1.15% NA
Temperate Japonica  767 18.90% 74.80% 6.26% 0.00% NA
Tropical Japonica  504 80.60% 17.50% 1.98% 0.00% NA
Japonica Intermediate  241 54.80% 41.10% 4.15% 0.00% NA
VI/Aromatic  96 44.80% 50.00% 1.04% 4.17% NA
Intermediate  90 68.90% 20.00% 8.89% 1.11% AT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323987975 A -> T LOC_Os03g43010.1 upstream_gene_variant ; 1165.0bp to feature; MODIFIER silent_mutation Average:66.169; most accessible tissue: Minghui63 root, score: 91.517 N N N N
vg0323987975 A -> T LOC_Os03g43000-LOC_Os03g43010 intergenic_region ; MODIFIER silent_mutation Average:66.169; most accessible tissue: Minghui63 root, score: 91.517 N N N N
vg0323987975 A -> DEL N N silent_mutation Average:66.169; most accessible tissue: Minghui63 root, score: 91.517 N N N N
vg0323987975 A -> AT LOC_Os03g43010.1 upstream_gene_variant ; 1164.0bp to feature; MODIFIER silent_mutation Average:66.169; most accessible tissue: Minghui63 root, score: 91.517 N N N N
vg0323987975 A -> AT LOC_Os03g43000-LOC_Os03g43010 intergenic_region ; MODIFIER silent_mutation Average:66.169; most accessible tissue: Minghui63 root, score: 91.517 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0323987975 A AT 0.14 0.03 -0.05 0.01 0.06 0.14
vg0323987975 A T -0.04 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323987975 NA 6.98E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 2.80E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 5.78E-08 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 1.63E-06 NA mr1304 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 6.74E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 6.38E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 6.25E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 4.41E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 2.77E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 8.61E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 1.11E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323987975 NA 1.59E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251