\
| Variant ID: vg0323975077 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23975077 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 263. )
TTAAGCGAAGAGTTCGTTGGACTTAGTCTTATAATTTACATATAAGTATTTGATACAACTTCTGTCTTAGTGTTAACAACCAAATTTGGTAAGCCATGAA[C/T]
TAGATTCGGCATTGGGATCGAAGCGGATTTGATAGAGAATTGTCTTCTGAAAACAAAGGGCGCATAGGCTACGAGGGCATCAGCTGAAGACTGCATCGGC
GCCGATGCAGTCTTCAGCTGATGCCCTCGTAGCCTATGCGCCCTTTGTTTTCAGAAGACAATTCTCTATCAAATCCGCTTCGATCCCAATGCCGAATCTA[G/A]
TTCATGGCTTACCAAATTTGGTTGTTAACACTAAGACAGAAGTTGTATCAAATACTTATATGTAAATTATAAGACTAAGTCCAACGAACTCTTCGCTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.80% | 0.70% | 0.53% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.20% | 2.10% | 1.65% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.80% | 4.20% | 3.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323975077 | C -> T | LOC_Os03g42990.1 | upstream_gene_variant ; 2491.0bp to feature; MODIFIER | silent_mutation | Average:51.088; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg0323975077 | C -> T | LOC_Os03g42970-LOC_Os03g42990 | intergenic_region ; MODIFIER | silent_mutation | Average:51.088; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323975077 | NA | 1.90E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323975077 | NA | 2.41E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323975077 | NA | 1.68E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323975077 | NA | 3.25E-08 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323975077 | 9.29E-07 | 9.29E-07 | mr1674 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323975077 | NA | 3.07E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323975077 | 2.14E-06 | 8.21E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323975077 | NA | 1.66E-08 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |