\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323975077:

Variant ID: vg0323975077 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23975077
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAGCGAAGAGTTCGTTGGACTTAGTCTTATAATTTACATATAAGTATTTGATACAACTTCTGTCTTAGTGTTAACAACCAAATTTGGTAAGCCATGAA[C/T]
TAGATTCGGCATTGGGATCGAAGCGGATTTGATAGAGAATTGTCTTCTGAAAACAAAGGGCGCATAGGCTACGAGGGCATCAGCTGAAGACTGCATCGGC

Reverse complement sequence

GCCGATGCAGTCTTCAGCTGATGCCCTCGTAGCCTATGCGCCCTTTGTTTTCAGAAGACAATTCTCTATCAAATCCGCTTCGATCCCAATGCCGAATCTA[G/A]
TTCATGGCTTACCAAATTTGGTTGTTAACACTAAGACAGAAGTTGTATCAAATACTTATATGTAAATTATAAGACTAAGTCCAACGAACTCTTCGCTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.80% 0.70% 0.53% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 96.20% 2.10% 1.65% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 92.80% 4.20% 3.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323975077 C -> T LOC_Os03g42990.1 upstream_gene_variant ; 2491.0bp to feature; MODIFIER silent_mutation Average:51.088; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N
vg0323975077 C -> T LOC_Os03g42970-LOC_Os03g42990 intergenic_region ; MODIFIER silent_mutation Average:51.088; most accessible tissue: Minghui63 flag leaf, score: 68.675 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323975077 NA 1.90E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323975077 NA 2.41E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323975077 NA 1.68E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323975077 NA 3.25E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323975077 9.29E-07 9.29E-07 mr1674 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323975077 NA 3.07E-07 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323975077 2.14E-06 8.21E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323975077 NA 1.66E-08 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251