Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323946857:

Variant ID: vg0323946857 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23946857
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAACGTTGTTCATAAATAAAATCTATGTTTAATTATGGATGTTGACTCCCCTTTGAGAAGATATCAATTACCCCATTTTCTAGATGAATGCGGGCAATGG[C/T,A]
AGTACGGGTGAAGGAGATACAGGAGAAATCCCTTCACCAAATCCTACCACCTTGGTAGAAGTAATGGCAACACAAACTCAATTATTACAAGCCATAGCAC

Reverse complement sequence

GTGCTATGGCTTGTAATAATTGAGTTTGTGTTGCCATTACTTCTACCAAGGTGGTAGGATTTGGTGAAGGGATTTCTCCTGTATCTCCTTCACCCGTACT[G/A,T]
CCATTGCCCGCATTCATCTAGAAAATGGGGTAATTGATATCTTCTCAAAGGGGAGTCAACATCCATAATTAAACATAGATTTTATTTATGAACAACGTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	98.10%	0.10%	0.34%	1.38%	A: 0.02%
All Indica	2759	99.30%	0.20%	0.43%	0.04%	A: 0.04%
All Japonica	1512	95.70%	0.00%	0.20%	4.10%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.00%	0.50%	0.00%	NA
Indica II	465	98.90%	0.40%	0.43%	0.00%	A: 0.22%
Indica III	913	99.20%	0.40%	0.33%	0.00%	NA
Indica Intermediate	786	99.40%	0.00%	0.51%	0.13%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	88.50%	0.00%	0.40%	11.11%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	97.80%	0.00%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323946857	C -> T	LOC_Os03g42930.1	upstream_gene_variant ; 3797.0bp to feature; MODIFIER	silent_mutation	Average:5.483; most accessible tissue: Callus, score: 10.772	N	N	N	N
vg0323946857	C -> T	LOC_Os03g42950.1	upstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:5.483; most accessible tissue: Callus, score: 10.772	N	N	N	N
vg0323946857	C -> T	LOC_Os03g42930-LOC_Os03g42950	intergenic_region ; MODIFIER	silent_mutation	Average:5.483; most accessible tissue: Callus, score: 10.772	N	N	N	N
vg0323946857	C -> A	LOC_Os03g42930.1	upstream_gene_variant ; 3797.0bp to feature; MODIFIER	silent_mutation	Average:5.483; most accessible tissue: Callus, score: 10.772	N	N	N	N
vg0323946857	C -> A	LOC_Os03g42950.1	upstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:5.483; most accessible tissue: Callus, score: 10.772	N	N	N	N
vg0323946857	C -> A	LOC_Os03g42930-LOC_Os03g42950	intergenic_region ; MODIFIER	silent_mutation	Average:5.483; most accessible tissue: Callus, score: 10.772	N	N	N	N
vg0323946857	C -> DEL	N	N	silent_mutation	Average:5.483; most accessible tissue: Callus, score: 10.772	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323946857	2.37E-06	2.84E-07	mr1925_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323946857	6.63E-07	NA	mr1925_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251