\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323946857:

Variant ID: vg0323946857 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23946857
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACGTTGTTCATAAATAAAATCTATGTTTAATTATGGATGTTGACTCCCCTTTGAGAAGATATCAATTACCCCATTTTCTAGATGAATGCGGGCAATGG[C/T,A]
AGTACGGGTGAAGGAGATACAGGAGAAATCCCTTCACCAAATCCTACCACCTTGGTAGAAGTAATGGCAACACAAACTCAATTATTACAAGCCATAGCAC

Reverse complement sequence

GTGCTATGGCTTGTAATAATTGAGTTTGTGTTGCCATTACTTCTACCAAGGTGGTAGGATTTGGTGAAGGGATTTCTCCTGTATCTCCTTCACCCGTACT[G/A,T]
CCATTGCCCGCATTCATCTAGAAAATGGGGTAATTGATATCTTCTCAAAGGGGAGTCAACATCCATAATTAAACATAGATTTTATTTATGAACAACGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 0.10% 0.34% 1.38% A: 0.02%
All Indica  2759 99.30% 0.20% 0.43% 0.04% A: 0.04%
All Japonica  1512 95.70% 0.00% 0.20% 4.10% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.00% 0.50% 0.00% NA
Indica II  465 98.90% 0.40% 0.43% 0.00% A: 0.22%
Indica III  913 99.20% 0.40% 0.33% 0.00% NA
Indica Intermediate  786 99.40% 0.00% 0.51% 0.13% NA
Temperate Japonica  767 99.70% 0.00% 0.13% 0.13% NA
Tropical Japonica  504 88.50% 0.00% 0.40% 11.11% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 97.80% 0.00% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323946857 C -> T LOC_Os03g42930.1 upstream_gene_variant ; 3797.0bp to feature; MODIFIER silent_mutation Average:5.483; most accessible tissue: Callus, score: 10.772 N N N N
vg0323946857 C -> T LOC_Os03g42950.1 upstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:5.483; most accessible tissue: Callus, score: 10.772 N N N N
vg0323946857 C -> T LOC_Os03g42930-LOC_Os03g42950 intergenic_region ; MODIFIER silent_mutation Average:5.483; most accessible tissue: Callus, score: 10.772 N N N N
vg0323946857 C -> A LOC_Os03g42930.1 upstream_gene_variant ; 3797.0bp to feature; MODIFIER silent_mutation Average:5.483; most accessible tissue: Callus, score: 10.772 N N N N
vg0323946857 C -> A LOC_Os03g42950.1 upstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:5.483; most accessible tissue: Callus, score: 10.772 N N N N
vg0323946857 C -> A LOC_Os03g42930-LOC_Os03g42950 intergenic_region ; MODIFIER silent_mutation Average:5.483; most accessible tissue: Callus, score: 10.772 N N N N
vg0323946857 C -> DEL N N silent_mutation Average:5.483; most accessible tissue: Callus, score: 10.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323946857 2.37E-06 2.84E-07 mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323946857 6.63E-07 NA mr1925_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251