\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323945949:

Variant ID: vg0323945949 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23945949
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCGCCGTAGCGCGTCGCGTCCGGATTGGCGCCGGCACGTCGCCAGCCAATTTCACACGCGGTCAAGCCAATCCTTCGCCAGTAAGTATTCAAACGTGG[C/T]
CTCCGCCACTCAAAGTGATCTTGGCCACCCTCTAACAGCTTCTGCCGCCCCAGCCATATCCAATCTTTGAGCTCATCCATGGTGATGACGGTGCCCGGGC

Reverse complement sequence

GCCCGGGCACCGTCATCACCATGGATGAGCTCAAAGATTGGATATGGCTGGGGCGGCAGAAGCTGTTAGAGGGTGGCCAAGATCACTTTGAGTGGCGGAG[G/A]
CCACGTTTGAATACTTACTGGCGAAGGATTGGCTTGACCGCGTGTGAAATTGGCTGGCGACGTGCCGGCGCCAATCCGGACGCGACGCGCTACGGCGGCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 37.10% 7.79% 0.21% NA
All Indica  2759 91.50% 3.50% 4.68% 0.33% NA
All Japonica  1512 0.70% 99.10% 0.13% 0.00% NA
Aus  269 8.20% 13.80% 77.70% 0.37% NA
Indica I  595 93.90% 2.90% 2.69% 0.50% NA
Indica II  465 89.20% 3.40% 7.10% 0.22% NA
Indica III  913 93.90% 2.30% 3.50% 0.33% NA
Indica Intermediate  786 88.30% 5.30% 6.11% 0.25% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.00% 98.80% 0.20% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 3.10% 76.00% 20.83% 0.00% NA
Intermediate  90 38.90% 52.20% 8.89% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323945949 C -> T LOC_Os03g42930.1 upstream_gene_variant ; 2889.0bp to feature; MODIFIER silent_mutation Average:49.771; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0323945949 C -> T LOC_Os03g42950.1 upstream_gene_variant ; 1092.0bp to feature; MODIFIER silent_mutation Average:49.771; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0323945949 C -> T LOC_Os03g42930-LOC_Os03g42950 intergenic_region ; MODIFIER silent_mutation Average:49.771; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N
vg0323945949 C -> DEL N N silent_mutation Average:49.771; most accessible tissue: Zhenshan97 flag leaf, score: 66.327 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323945949 NA 1.74E-34 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 1.94E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 9.21E-12 mr1938 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 5.76E-50 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 3.96E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 1.87E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 2.53E-21 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 5.46E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 1.05E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 4.10E-56 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 2.30E-11 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 1.10E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 6.29E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 9.21E-08 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 8.76E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 5.72E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 3.56E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 NA 8.50E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949 1.91E-07 1.46E-09 mr1987_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251