Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323945949:

Variant ID: vg0323945949 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23945949
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CGCCGCCGTAGCGCGTCGCGTCCGGATTGGCGCCGGCACGTCGCCAGCCAATTTCACACGCGGTCAAGCCAATCCTTCGCCAGTAAGTATTCAAACGTGG[C/T]
CTCCGCCACTCAAAGTGATCTTGGCCACCCTCTAACAGCTTCTGCCGCCCCAGCCATATCCAATCTTTGAGCTCATCCATGGTGATGACGGTGCCCGGGC

Reverse complement sequence

GCCCGGGCACCGTCATCACCATGGATGAGCTCAAAGATTGGATATGGCTGGGGCGGCAGAAGCTGTTAGAGGGTGGCCAAGATCACTTTGAGTGGCGGAG[G/A]
CCACGTTTGAATACTTACTGGCGAAGGATTGGCTTGACCGCGTGTGAAATTGGCTGGCGACGTGCCGGCGCCAATCCGGACGCGACGCGCTACGGCGGCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	37.10%	7.79%	0.21%	NA
All Indica	2759	91.50%	3.50%	4.68%	0.33%	NA
All Japonica	1512	0.70%	99.10%	0.13%	0.00%	NA
Aus	269	8.20%	13.80%	77.70%	0.37%	NA
Indica I	595	93.90%	2.90%	2.69%	0.50%	NA
Indica II	465	89.20%	3.40%	7.10%	0.22%	NA
Indica III	913	93.90%	2.30%	3.50%	0.33%	NA
Indica Intermediate	786	88.30%	5.30%	6.11%	0.25%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.00%	98.80%	0.20%	0.00%	NA
Japonica Intermediate	241	1.20%	98.30%	0.41%	0.00%	NA
VI/Aromatic	96	3.10%	76.00%	20.83%	0.00%	NA
Intermediate	90	38.90%	52.20%	8.89%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323945949	C -> T	LOC_Os03g42930.1	upstream_gene_variant ; 2889.0bp to feature; MODIFIER	silent_mutation	Average:49.771; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0323945949	C -> T	LOC_Os03g42950.1	upstream_gene_variant ; 1092.0bp to feature; MODIFIER	silent_mutation	Average:49.771; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0323945949	C -> T	LOC_Os03g42930-LOC_Os03g42950	intergenic_region ; MODIFIER	silent_mutation	Average:49.771; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N
vg0323945949	C -> DEL	N	N	silent_mutation	Average:49.771; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323945949	NA	1.74E-34	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	1.94E-23	mr1862	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	9.21E-12	mr1938	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	5.76E-50	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	3.96E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	1.87E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	2.53E-21	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	5.46E-22	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	1.05E-23	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	4.10E-56	mr1558_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	2.30E-11	mr1728_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	1.10E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	6.29E-09	mr1751_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	9.21E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	8.76E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	5.72E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	3.56E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	NA	8.50E-25	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323945949	1.91E-07	1.46E-09	mr1987_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251