\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323939684:

Variant ID: vg0323939684 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23939684
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTGTAGTTGCTTGTATTTGAATTTTTGGGAGATAAGATCTGCTCCAATGCTCCATGAACTTAAGGGTGTACAGGCCACACGAGACGCTACAAGAATTT[A/G]
GTCGTTGTGCTAACACGTTACCGTAATTGAAAAATGTGAATATCATGTGGAAGAGTTTGAGTCACCCACCCGTCTCCTTGCTTTGGCAATTTTTGGACTT

Reverse complement sequence

AAGTCCAAAAATTGCCAAAGCAAGGAGACGGGTGGGTGACTCAAACTCTTCCACATGATATTCACATTTTTCAATTACGGTAACGTGTTAGCACAACGAC[T/C]
AAATTCTTGTAGCGTCTCGTGTGGCCTGTACACCCTTAAGTTCATGGAGCATTGGAGCAGATCTTATCTCCCAAAAATTCAAATACAAGCAACTACAACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 41.20% 0.38% 0.17% NA
All Indica  2759 96.80% 2.40% 0.62% 0.18% NA
All Japonica  1512 0.70% 99.20% 0.00% 0.07% NA
Aus  269 8.90% 90.70% 0.37% 0.00% NA
Indica I  595 96.80% 1.00% 2.18% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 98.70% 1.10% 0.00% 0.22% NA
Indica Intermediate  786 93.80% 5.30% 0.51% 0.38% NA
Temperate Japonica  767 0.40% 99.50% 0.00% 0.13% NA
Tropical Japonica  504 1.00% 99.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 46.70% 51.10% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323939684 A -> DEL N N silent_mutation Average:50.265; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0323939684 A -> G LOC_Os03g42920.1 upstream_gene_variant ; 859.0bp to feature; MODIFIER silent_mutation Average:50.265; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0323939684 A -> G LOC_Os03g42910.1 downstream_gene_variant ; 1685.0bp to feature; MODIFIER silent_mutation Average:50.265; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0323939684 A -> G LOC_Os03g42930.1 downstream_gene_variant ; 352.0bp to feature; MODIFIER silent_mutation Average:50.265; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N
vg0323939684 A -> G LOC_Os03g42920-LOC_Os03g42930 intergenic_region ; MODIFIER silent_mutation Average:50.265; most accessible tissue: Minghui63 flag leaf, score: 66.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323939684 NA 2.63E-50 mr1063 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 3.96E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.89E-79 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 3.05E-32 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 8.19E-29 mr1793 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 8.76E-53 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 3.08E-12 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 2.50E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.11E-19 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 7.30E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 2.69E-16 mr1260_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 3.96E-22 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 3.02E-24 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.36E-45 mr1509_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.70E-60 mr1558_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 5.95E-32 mr1571_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 3.67E-10 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.44E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 9.66E-16 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.03E-40 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 2.89E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.38E-44 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.46E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 2.50E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 3.91E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.20E-21 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 3.38E-30 mr1932_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 NA 1.47E-25 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323939684 6.21E-06 NA mr1987_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251