\
| Variant ID: vg0323895857 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23895857 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCATCTCCACTGCCCTGGGAGCCAAGAGAGAGAGAGAGCAGGAAAGAGAGACGCCGGCGGTGCTCGACGCATCACGCGTGGCCAGGACGTGGCAACGCTG[A/G]
GCTCCTCCCTTTTCTTCCTCAGACGTGTCGCCTTCTCTTCTACATTCTTCTGGAGCCGAACTACTCGGACGAGAGAGAGCCCTATGCCTCTCCGTCGCCC
GGGCGACGGAGAGGCATAGGGCTCTCTCTCGTCCGAGTAGTTCGGCTCCAGAAGAATGTAGAAGAGAAGGCGACACGTCTGAGGAAGAAAAGGGAGGAGC[T/C]
CAGCGTTGCCACGTCCTGGCCACGCGTGATGCGTCGAGCACCGCCGGCGTCTCTCTTTCCTGCTCTCTCTCTCTCTTGGCTCCCAGGGCAGTGGAGATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 5.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 13.40% | 86.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 1.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323895857 | A -> G | LOC_Os03g42850.1 | upstream_gene_variant ; 2999.0bp to feature; MODIFIER | silent_mutation | Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0323895857 | A -> G | LOC_Os03g42840.1 | downstream_gene_variant ; 376.0bp to feature; MODIFIER | silent_mutation | Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0323895857 | A -> G | LOC_Os03g42860.1 | downstream_gene_variant ; 4291.0bp to feature; MODIFIER | silent_mutation | Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| vg0323895857 | A -> G | LOC_Os03g42840-LOC_Os03g42850 | intergenic_region ; MODIFIER | silent_mutation | Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323895857 | NA | 2.71E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | NA | 3.09E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | NA | 1.22E-06 | mr1320 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | NA | 6.74E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | NA | 5.11E-19 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | 7.32E-06 | NA | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | NA | 4.89E-07 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | NA | 2.87E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | NA | 1.28E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | NA | 1.69E-09 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895857 | 7.36E-07 | NA | mr1940_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |