\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323895857:

Variant ID: vg0323895857 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23895857
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATCTCCACTGCCCTGGGAGCCAAGAGAGAGAGAGAGCAGGAAAGAGAGACGCCGGCGGTGCTCGACGCATCACGCGTGGCCAGGACGTGGCAACGCTG[A/G]
GCTCCTCCCTTTTCTTCCTCAGACGTGTCGCCTTCTCTTCTACATTCTTCTGGAGCCGAACTACTCGGACGAGAGAGAGCCCTATGCCTCTCCGTCGCCC

Reverse complement sequence

GGGCGACGGAGAGGCATAGGGCTCTCTCTCGTCCGAGTAGTTCGGCTCCAGAAGAATGTAGAAGAGAAGGCGACACGTCTGAGGAAGAAAAGGGAGGAGC[T/C]
CAGCGTTGCCACGTCCTGGCCACGCGTGATGCGTCGAGCACCGCCGGCGTCTCTCTTTCCTGCTCTCTCTCTCTCTTGGCTCCCAGGGCAGTGGAGATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.50% 0.02% 0.00% NA
All Indica  2759 99.30% 0.70% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 13.40% 86.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 1.90% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323895857 A -> G LOC_Os03g42850.1 upstream_gene_variant ; 2999.0bp to feature; MODIFIER silent_mutation Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0323895857 A -> G LOC_Os03g42840.1 downstream_gene_variant ; 376.0bp to feature; MODIFIER silent_mutation Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0323895857 A -> G LOC_Os03g42860.1 downstream_gene_variant ; 4291.0bp to feature; MODIFIER silent_mutation Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N
vg0323895857 A -> G LOC_Os03g42840-LOC_Os03g42850 intergenic_region ; MODIFIER silent_mutation Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323895857 NA 2.71E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 NA 3.09E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 NA 1.22E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 NA 6.74E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 NA 5.11E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 7.32E-06 NA mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 NA 4.89E-07 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 NA 2.87E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 NA 1.28E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 NA 1.69E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857 7.36E-07 NA mr1940_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251