Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0323895857:

Variant ID: vg0323895857 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23895857
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCATCTCCACTGCCCTGGGAGCCAAGAGAGAGAGAGAGCAGGAAAGAGAGACGCCGGCGGTGCTCGACGCATCACGCGTGGCCAGGACGTGGCAACGCTG[A/G]
GCTCCTCCCTTTTCTTCCTCAGACGTGTCGCCTTCTCTTCTACATTCTTCTGGAGCCGAACTACTCGGACGAGAGAGAGCCCTATGCCTCTCCGTCGCCC

Reverse complement sequence

GGGCGACGGAGAGGCATAGGGCTCTCTCTCGTCCGAGTAGTTCGGCTCCAGAAGAATGTAGAAGAGAAGGCGACACGTCTGAGGAAGAAAAGGGAGGAGC[T/C]
CAGCGTTGCCACGTCCTGGCCACGCGTGATGCGTCGAGCACCGCCGGCGTCTCTCTTTCCTGCTCTCTCTCTCTCTTGGCTCCCAGGGCAGTGGAGATGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	5.50%	0.02%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.04%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	13.40%	86.60%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.00%	1.90%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323895857	A -> G	LOC_Os03g42850.1	upstream_gene_variant ; 2999.0bp to feature; MODIFIER	silent_mutation	Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0323895857	A -> G	LOC_Os03g42840.1	downstream_gene_variant ; 376.0bp to feature; MODIFIER	silent_mutation	Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0323895857	A -> G	LOC_Os03g42860.1	downstream_gene_variant ; 4291.0bp to feature; MODIFIER	silent_mutation	Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N
vg0323895857	A -> G	LOC_Os03g42840-LOC_Os03g42850	intergenic_region ; MODIFIER	silent_mutation	Average:38.369; most accessible tissue: Minghui63 panicle, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323895857	NA	2.71E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	NA	3.09E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	NA	1.22E-06	mr1320	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	NA	6.74E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	NA	5.11E-19	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	7.32E-06	NA	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	NA	4.89E-07	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	NA	2.87E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	NA	1.28E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	NA	1.69E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895857	7.36E-07	NA	mr1940_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251