Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323895795:

Variant ID: vg0323895795 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23895795
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTGACGTGGTATCCACGGTAACGCTACGGGTCAGTTGGGACCCACATGTCAGCTCTGTGCATCATCTCCACTGCCCTGGGAGCCAAGAGAGAGAGAGAG[C/A]
AGGAAAGAGAGACGCCGGCGGTGCTCGACGCATCACGCGTGGCCAGGACGTGGCAACGCTGAGCTCCTCCCTTTTCTTCCTCAGACGTGTCGCCTTCTCT

Reverse complement sequence

AGAGAAGGCGACACGTCTGAGGAAGAAAAGGGAGGAGCTCAGCGTTGCCACGTCCTGGCCACGCGTGATGCGTCGAGCACCGCCGGCGTCTCTCTTTCCT[G/T]
CTCTCTCTCTCTCTTGGCTCCCAGGGCAGTGGAGATGATGCACAGAGCTGACATGTGGGTCCCAACTGACCCGTAGCGTTACCGTGGATACCACGTCAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	4.80%	0.57%	0.00%	NA
All Indica	2759	99.30%	0.60%	0.07%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	20.80%	74.70%	4.46%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.20%	1.50%	0.25%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	83.30%	6.20%	10.42%	0.00%	NA
Intermediate	90	93.30%	4.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323895795	C -> A	LOC_Os03g42850.1	upstream_gene_variant ; 3061.0bp to feature; MODIFIER	silent_mutation	Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0323895795	C -> A	LOC_Os03g42840.1	downstream_gene_variant ; 314.0bp to feature; MODIFIER	silent_mutation	Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0323895795	C -> A	LOC_Os03g42860.1	downstream_gene_variant ; 4353.0bp to feature; MODIFIER	silent_mutation	Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0323895795	C -> A	LOC_Os03g42840-LOC_Os03g42850	intergenic_region ; MODIFIER	silent_mutation	Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323895795	5.48E-06	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795	9.22E-06	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795	9.81E-06	NA	mr1247_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795	1.08E-06	5.41E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795	NA	6.58E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795	7.96E-06	NA	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795	NA	8.35E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795	NA	3.96E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795	NA	3.84E-10	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795	5.15E-06	NA	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251