\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323895795:

Variant ID: vg0323895795 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23895795
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTGACGTGGTATCCACGGTAACGCTACGGGTCAGTTGGGACCCACATGTCAGCTCTGTGCATCATCTCCACTGCCCTGGGAGCCAAGAGAGAGAGAGAG[C/A]
AGGAAAGAGAGACGCCGGCGGTGCTCGACGCATCACGCGTGGCCAGGACGTGGCAACGCTGAGCTCCTCCCTTTTCTTCCTCAGACGTGTCGCCTTCTCT

Reverse complement sequence

AGAGAAGGCGACACGTCTGAGGAAGAAAAGGGAGGAGCTCAGCGTTGCCACGTCCTGGCCACGCGTGATGCGTCGAGCACCGCCGGCGTCTCTCTTTCCT[G/T]
CTCTCTCTCTCTCTTGGCTCCCAGGGCAGTGGAGATGATGCACAGAGCTGACATGTGGGTCCCAACTGACCCGTAGCGTTACCGTGGATACCACGTCAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 4.80% 0.57% 0.00% NA
All Indica  2759 99.30% 0.60% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 20.80% 74.70% 4.46% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.20% 1.50% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 83.30% 6.20% 10.42% 0.00% NA
Intermediate  90 93.30% 4.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323895795 C -> A LOC_Os03g42850.1 upstream_gene_variant ; 3061.0bp to feature; MODIFIER silent_mutation Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0323895795 C -> A LOC_Os03g42840.1 downstream_gene_variant ; 314.0bp to feature; MODIFIER silent_mutation Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0323895795 C -> A LOC_Os03g42860.1 downstream_gene_variant ; 4353.0bp to feature; MODIFIER silent_mutation Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0323895795 C -> A LOC_Os03g42840-LOC_Os03g42850 intergenic_region ; MODIFIER silent_mutation Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323895795 5.48E-06 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795 9.22E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795 9.81E-06 NA mr1247_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795 1.08E-06 5.41E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795 NA 6.58E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795 7.96E-06 NA mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795 NA 8.35E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795 NA 3.96E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795 NA 3.84E-10 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323895795 5.15E-06 NA mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251