| Variant ID: vg0323895795 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23895795 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCTGACGTGGTATCCACGGTAACGCTACGGGTCAGTTGGGACCCACATGTCAGCTCTGTGCATCATCTCCACTGCCCTGGGAGCCAAGAGAGAGAGAGAG[C/A]
AGGAAAGAGAGACGCCGGCGGTGCTCGACGCATCACGCGTGGCCAGGACGTGGCAACGCTGAGCTCCTCCCTTTTCTTCCTCAGACGTGTCGCCTTCTCT
AGAGAAGGCGACACGTCTGAGGAAGAAAAGGGAGGAGCTCAGCGTTGCCACGTCCTGGCCACGCGTGATGCGTCGAGCACCGCCGGCGTCTCTCTTTCCT[G/T]
CTCTCTCTCTCTCTTGGCTCCCAGGGCAGTGGAGATGATGCACAGAGCTGACATGTGGGTCCCAACTGACCCGTAGCGTTACCGTGGATACCACGTCAGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 4.80% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 20.80% | 74.70% | 4.46% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.20% | 1.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 6.20% | 10.42% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 4.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323895795 | C -> A | LOC_Os03g42850.1 | upstream_gene_variant ; 3061.0bp to feature; MODIFIER | silent_mutation | Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0323895795 | C -> A | LOC_Os03g42840.1 | downstream_gene_variant ; 314.0bp to feature; MODIFIER | silent_mutation | Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0323895795 | C -> A | LOC_Os03g42860.1 | downstream_gene_variant ; 4353.0bp to feature; MODIFIER | silent_mutation | Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0323895795 | C -> A | LOC_Os03g42840-LOC_Os03g42850 | intergenic_region ; MODIFIER | silent_mutation | Average:44.474; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323895795 | 5.48E-06 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895795 | 9.22E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895795 | 9.81E-06 | NA | mr1247_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895795 | 1.08E-06 | 5.41E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895795 | NA | 6.58E-06 | mr1344_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895795 | 7.96E-06 | NA | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895795 | NA | 8.35E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895795 | NA | 3.96E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895795 | NA | 3.84E-10 | mr1860_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323895795 | 5.15E-06 | NA | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |