Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323869447:

Variant ID: vg0323869447 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23869447
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTTTTTGGGTGTAAAGTTTTTGAAGTATACGGACACACATTTGAAGTATTAAACGTAGACTAATAACAAAACAAATTACAGATTCCGCCTATAAATC[G/A]
CGATATGAATTTATTAAGCCTAATTAATCCATCATTAGCAAATGTTTACTATAACATCACATTGTGAAATCATGGCGTAATTAAGCTCAAAAGATTCGTC

Reverse complement sequence

GACGAATCTTTTGAGCTTAATTACGCCATGATTTCACAATGTGATGTTATAGTAAACATTTGCTAATGATGGATTAATTAGGCTTAATAAATTCATATCG[C/T]
GATTTATAGGCGGAATCTGTAATTTGTTTTGTTATTAGTCTACGTTTAATACTTCAAATGTGTGTCCGTATACTTCAAAAACTTTACACCCAAAAAACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 14.00% 0.11% 0.00% NA
All Indica  2759 78.00% 21.80% 0.18% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 66.60% 33.10% 0.34% 0.00% NA
Indica II  465 85.20% 14.40% 0.43% 0.00% NA
Indica III  913 79.00% 21.00% 0.00% 0.00% NA
Indica Intermediate  786 81.40% 18.40% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323869447 G -> A LOC_Os03g42830.1 downstream_gene_variant ; 736.0bp to feature; MODIFIER silent_mutation Average:45.381; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg0323869447 G -> A LOC_Os03g42820-LOC_Os03g42830 intergenic_region ; MODIFIER silent_mutation Average:45.381; most accessible tissue: Minghui63 root, score: 76.119 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323869447 NA 1.10E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 1.00E-06 mr1653 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 2.16E-07 mr1685 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 1.15E-06 mr1816 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 3.26E-06 mr1816 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 5.07E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 4.76E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 9.17E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 2.16E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 7.65E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323869447 NA 4.71E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251