\
| Variant ID: vg0323869447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23869447 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 126. )
AAGTTTTTTGGGTGTAAAGTTTTTGAAGTATACGGACACACATTTGAAGTATTAAACGTAGACTAATAACAAAACAAATTACAGATTCCGCCTATAAATC[G/A]
CGATATGAATTTATTAAGCCTAATTAATCCATCATTAGCAAATGTTTACTATAACATCACATTGTGAAATCATGGCGTAATTAAGCTCAAAAGATTCGTC
GACGAATCTTTTGAGCTTAATTACGCCATGATTTCACAATGTGATGTTATAGTAAACATTTGCTAATGATGGATTAATTAGGCTTAATAAATTCATATCG[C/T]
GATTTATAGGCGGAATCTGTAATTTGTTTTGTTATTAGTCTACGTTTAATACTTCAAATGTGTGTCCGTATACTTCAAAAACTTTACACCCAAAAAACTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.90% | 14.00% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 78.00% | 21.80% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 79.90% | 20.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 66.60% | 33.10% | 0.34% | 0.00% | NA |
| Indica II | 465 | 85.20% | 14.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 79.00% | 21.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.40% | 18.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323869447 | G -> A | LOC_Os03g42830.1 | downstream_gene_variant ; 736.0bp to feature; MODIFIER | silent_mutation | Average:45.381; most accessible tissue: Minghui63 root, score: 76.119 | N | N | N | N |
| vg0323869447 | G -> A | LOC_Os03g42820-LOC_Os03g42830 | intergenic_region ; MODIFIER | silent_mutation | Average:45.381; most accessible tissue: Minghui63 root, score: 76.119 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323869447 | NA | 1.10E-06 | mr1408 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 1.00E-06 | mr1653 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 2.16E-07 | mr1685 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 1.15E-06 | mr1816 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 3.26E-06 | mr1816 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 5.07E-06 | mr1968 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 4.76E-08 | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 9.17E-06 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 2.16E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 7.65E-06 | mr1266_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323869447 | NA | 4.71E-07 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |