\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323864753:

Variant ID: vg0323864753 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23864753
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACATCGGATACTCCGACACTTAGAAAAACTCACTCGAAAGGATTTTTCAAACAAAGACAGAGAGTGAAGTTCTGTGAAAAATCGGATAGTCCGATACAT[T/C]
GGATAGTCTGATTTCAAATCGGATAGTCTGATGTTGCTCAAGTAAAAATGCAATAACTTTTTACTCCGAACTCCGATTTCAAAGATCTTGGACTCTATGG

Reverse complement sequence

CCATAGAGTCCAAGATCTTTGAAATCGGAGTTCGGAGTAAAAAGTTATTGCATTTTTACTTGAGCAACATCAGACTATCCGATTTGAAATCAGACTATCC[A/G]
ATGTATCGGACTATCCGATTTTTCACAGAACTTCACTCTCTGTCTTTGTTTGAAAAATCCTTTCGAGTGAGTTTTTCTAAGTGTCGGAGTATCCGATGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 36.00% 0.28% 0.00% NA
All Indica  2759 97.90% 1.80% 0.33% 0.00% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 93.30% 5.60% 1.12% 0.00% NA
Indica I  595 98.00% 0.80% 1.18% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.30% 0.25% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 47.80% 51.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323864753 T -> C LOC_Os03g42820.1 downstream_gene_variant ; 2812.0bp to feature; MODIFIER silent_mutation Average:21.623; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0323864753 T -> C LOC_Os03g42820.2 downstream_gene_variant ; 2812.0bp to feature; MODIFIER silent_mutation Average:21.623; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0323864753 T -> C LOC_Os03g42820.4 downstream_gene_variant ; 2812.0bp to feature; MODIFIER silent_mutation Average:21.623; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0323864753 T -> C LOC_Os03g42820.3 downstream_gene_variant ; 2812.0bp to feature; MODIFIER silent_mutation Average:21.623; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg0323864753 T -> C LOC_Os03g42820-LOC_Os03g42830 intergenic_region ; MODIFIER silent_mutation Average:21.623; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323864753 NA 2.50E-105 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 4.71E-103 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 2.85E-72 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 8.02E-71 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 1.10E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 1.10E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 8.19E-23 mr1571 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 1.16E-56 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 2.24E-81 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 1.19E-87 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 3.37E-06 8.57E-137 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 2.59E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 1.07E-38 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 4.41E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 1.32E-105 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 6.70E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 7.41E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 2.16E-36 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 8.33E-122 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 1.65E-07 5.99E-183 mr1750_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323864753 NA 1.66E-153 mr1987_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251