\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323714977:

Variant ID: vg0323714977 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23714977
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAACTGTTAAACGATGTGTTTCGTGCGAAAACTTTCTATATGAAAGTTGCTTTAAAATATCATATTAATCTATTTTTCAAGTTTGTGATAATTAAAAC[C/T,A]
CAATCAATCATAAGTTAATACCACCTCGTTTTGCGTAAAAAACTTAATATTCATCTTCATCTTCAGGAGATTCAAACACCACCTTAATTCTTATCTTTGT

Reverse complement sequence

ACAAAGATAAGAATTAAGGTGGTGTTTGAATCTCCTGAAGATGAAGATGAATATTAAGTTTTTTACGCAAAACGAGGTGGTATTAACTTATGATTGATTG[G/A,T]
GTTTTAATTATCACAAACTTGAAAAATAGATTAATATGATATTTTAAAGCAACTTTCATATAGAAAGTTTTCGCACGAAACACATCGTTTAACAGTTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.70% 0.20% 0.06% 0.00% A: 0.06%
All Indica  2759 99.90% 0.00% 0.00% 0.00% A: 0.07%
All Japonica  1512 99.30% 0.50% 0.20% 0.00% A: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.00% 0.00% A: 0.25%
Temperate Japonica  767 99.70% 0.00% 0.13% 0.00% A: 0.13%
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 1.70% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323714977 C -> T LOC_Os03g42600.1 upstream_gene_variant ; 195.0bp to feature; MODIFIER N Average:72.224; most accessible tissue: Minghui63 flower, score: 85.099 N N N N
vg0323714977 C -> T LOC_Os03g42610.1 downstream_gene_variant ; 3093.0bp to feature; MODIFIER N Average:72.224; most accessible tissue: Minghui63 flower, score: 85.099 N N N N
vg0323714977 C -> T LOC_Os03g42590-LOC_Os03g42600 intergenic_region ; MODIFIER N Average:72.224; most accessible tissue: Minghui63 flower, score: 85.099 N N N N
vg0323714977 C -> A LOC_Os03g42600.1 upstream_gene_variant ; 195.0bp to feature; MODIFIER N Average:72.224; most accessible tissue: Minghui63 flower, score: 85.099 N N N N
vg0323714977 C -> A LOC_Os03g42610.1 downstream_gene_variant ; 3093.0bp to feature; MODIFIER N Average:72.224; most accessible tissue: Minghui63 flower, score: 85.099 N N N N
vg0323714977 C -> A LOC_Os03g42590-LOC_Os03g42600 intergenic_region ; MODIFIER N Average:72.224; most accessible tissue: Minghui63 flower, score: 85.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323714977 5.97E-06 NA mr1277 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251