\
| Variant ID: vg0323711509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23711509 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAAAATACCAGTACAATATTTGGCATCGTCCAATTTAATTCCGGAATTACACCGGATATCCTTGGCGCCGGGCCCCCGATGCCACTAGAAAAAATCGGG[C/T]
GCATCGGGCGCCCGCGCCTTCGCCTCTAGCCCACGCGCCGCCCCCACACCCTAGCATATACGCCGTTGCAACAAATCACCCACATATTTTGGAAACCCTC
GAGGGTTTCCAAAATATGTGGGTGATTTGTTGCAACGGCGTATATGCTAGGGTGTGGGGGCGGCGCGTGGGCTAGAGGCGAAGGCGCGGGCGCCCGATGC[G/A]
CCCGATTTTTTCTAGTGGCATCGGGGGCCCGGCGCCAAGGATATCCGGTGTAATTCCGGAATTAAATTGGACGATGCCAAATATTGTACTGGTATTTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.20% | 8.70% | 1.06% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 70.90% | 26.00% | 3.11% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.00% | 4.40% | 3.52% | 0.00% | NA |
| Tropical Japonica | 504 | 40.90% | 56.30% | 2.78% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.40% | 31.10% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323711509 | C -> T | LOC_Os03g42600.1 | upstream_gene_variant ; 3663.0bp to feature; MODIFIER | silent_mutation | Average:59.173; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| vg0323711509 | C -> T | LOC_Os03g42590-LOC_Os03g42600 | intergenic_region ; MODIFIER | silent_mutation | Average:59.173; most accessible tissue: Zhenshan97 panicle, score: 84.824 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323711509 | NA | 1.30E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 2.78E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 1.17E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 5.82E-08 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | 2.02E-06 | 3.71E-40 | mr1699 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 1.80E-21 | mr1699 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 2.49E-11 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 3.71E-14 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 5.58E-06 | mr1425_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 6.09E-07 | mr1425_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 4.15E-08 | mr1510_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 6.08E-07 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 7.15E-06 | mr1553_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 6.38E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 8.69E-33 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 4.17E-17 | mr1699_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 2.46E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 1.62E-14 | mr1742_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 1.40E-10 | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323711509 | NA | 1.42E-19 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |