\
| Variant ID: vg0323673178 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23673178 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )
CGATTGCAGTCAAGAGGAGCTTGATGCTTATGTGGCAGGAGAAGTGAAGAGGCAACTCAAGCCTCGGAGTCATGAAAAGAAGATACCTATTGACCCGAGC[G/A]
TGAAGAACTTCTTCAAGGGAATGTCCACAACAAACAAGGATGCCTTAAAGATATCGGACTATGACCGAACACTTCAGAAAGCCCATCACAAGAAGTCCAA
TTGGACTTCTTGTGATGGGCTTTCTGAAGTGTTCGGTCATAGTCCGATATCTTTAAGGCATCCTTGTTTGTTGTGGACATTCCCTTGAAGAAGTTCTTCA[C/T]
GCTCGGGTCAATAGGTATCTTCTTTTCATGACTCCGAGGCTTGAGTTGCCTCTTCACTTCTCCTGCCACATAAGCATCAAGCTCCTCTTGACTGCAATCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.40% | 21.20% | 0.32% | 0.04% | NA |
| All Indica | 2759 | 99.10% | 0.70% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 36.30% | 63.10% | 0.46% | 0.13% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 51.80% | 48.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 17.50% | 81.90% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 26.60% | 71.40% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 23.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323673178 | G -> A | LOC_Os03g42540.1 | missense_variant ; p.Val58Met; MODERATE | nonsynonymous_codon ; V58M | Average:38.052; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | benign |
0.92 |
DELETERIOUS | 0.05 |
| vg0323673178 | G -> DEL | LOC_Os03g42540.1 | N | frameshift_variant | Average:38.052; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323673178 | NA | 1.17E-11 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323673178 | NA | 1.31E-12 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323673178 | NA | 4.27E-07 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323673178 | NA | 4.75E-07 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323673178 | 4.25E-06 | 5.30E-09 | mr1559_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323673178 | 7.65E-06 | 2.50E-08 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323673178 | 1.67E-07 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323673178 | NA | 7.22E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323673178 | NA | 1.59E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323673178 | NA | 2.88E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |