Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323669384:

Variant ID: vg0323669384 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23669384
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCTAGGCCTCATCTTTTCTCTTATGCTTATGCTTATCAGTTAAAATTTAAATTTTTGACCTTAAATTTGGAGTTGATTTTGAGGGTTTTTTCATCGAA[A/G]
TTTATTTTTCAGCTTTTACTTTTAGATCGCTAAGAACACGTAAATAAAAGTTTTATTCACAAGTTATTTTACGTTTACAAATATGCCGTATCGTTTATTG

Reverse complement sequence

CAATAAACGATACGGCATATTTGTAAACGTAAAATAACTTGTGAATAAAACTTTTATTTACGTGTTCTTAGCGATCTAAAAGTAAAAGCTGAAAAATAAA[T/C]
TTCGATGAAAAAACCCTCAAAATCAACTCCAAATTTAAGGTCAAAAATTTAAATTTTAACTGATAAGCATAAGCATAAGAGAAAAGATGAGGCCTAGATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	13.10%	0.19%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.00%	0.00%	NA
All Japonica	1512	65.30%	34.10%	0.60%	0.00%	NA
Aus	269	94.40%	5.60%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	47.60%	51.60%	0.78%	0.00%	NA
Tropical Japonica	504	87.70%	12.30%	0.00%	0.00%	NA
Japonica Intermediate	241	74.70%	24.10%	1.24%	0.00%	NA
VI/Aromatic	96	38.50%	61.50%	0.00%	0.00%	NA
Intermediate	90	81.10%	18.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323669384	A -> G	LOC_Os03g42540.1	upstream_gene_variant ; 2225.0bp to feature; MODIFIER	silent_mutation	Average:53.51; most accessible tissue: Zhenshan97 flower, score: 83.812	N	N	N	N
vg0323669384	A -> G	LOC_Os03g42530.1	downstream_gene_variant ; 1772.0bp to feature; MODIFIER	silent_mutation	Average:53.51; most accessible tissue: Zhenshan97 flower, score: 83.812	N	N	N	N
vg0323669384	A -> G	LOC_Os03g42530-LOC_Os03g42540	intergenic_region ; MODIFIER	silent_mutation	Average:53.51; most accessible tissue: Zhenshan97 flower, score: 83.812	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323669384	4.72E-06	NA	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323669384	9.57E-06	NA	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323669384	NA	1.40E-07	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323669384	5.42E-06	2.02E-07	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323669384	NA	1.19E-07	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323669384	1.72E-06	NA	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323669384	2.26E-06	2.26E-06	mr1649_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323669384	NA	1.70E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251