\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323622322:

Variant ID: vg0323622322 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23622322
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


ATCCATCTCTTAATTATACCCCTCAAATAGACTCCAACCACTCTCCCAATGCACCCATGAGGGAGGAGGCGAAGAGTTGGTAATTAGGGCAACAATGATC[A/G]
TCAATGGTTGGAGTCCTTGGAGCTGACATAGATGACACGATATGAAGAGAATAATCCTTCGCTTTCCTTCCCTTTCCTTCTCGGCCTCCTTTCGCCAACA

Reverse complement sequence

TGTTGGCGAAAGGAGGCCGAGAAGGAAAGGGAAGGAAAGCGAAGGATTATTCTCTTCATATCGTGTCATCTATGTCAGCTCCAAGGACTCCAACCATTGA[T/C]
GATCATTGTTGCCCTAATTACCAACTCTTCGCCTCCTCCCTCATGGGTGCATTGGGAGAGTGGTTGGAGTCTATTTGAGGGGTATAATTAAGAGATGGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 31.70% 0.70% 0.34% NA
All Indica  2759 98.80% 0.90% 0.04% 0.29% NA
All Japonica  1512 7.90% 89.70% 2.05% 0.33% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.00% 0.17% NA
Indica II  465 98.90% 0.90% 0.00% 0.22% NA
Indica III  913 99.10% 0.40% 0.00% 0.44% NA
Indica Intermediate  786 97.80% 1.80% 0.13% 0.25% NA
Temperate Japonica  767 6.60% 90.40% 2.87% 0.13% NA
Tropical Japonica  504 7.30% 91.90% 0.40% 0.40% NA
Japonica Intermediate  241 13.30% 83.00% 2.90% 0.83% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 53.30% 42.20% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323622322 A -> DEL N N silent_mutation Average:72.182; most accessible tissue: Callus, score: 92.01 N N N N
vg0323622322 A -> G LOC_Os03g42440.1 upstream_gene_variant ; 2062.0bp to feature; MODIFIER silent_mutation Average:72.182; most accessible tissue: Callus, score: 92.01 N N N N
vg0323622322 A -> G LOC_Os03g42450.1 upstream_gene_variant ; 1019.0bp to feature; MODIFIER silent_mutation Average:72.182; most accessible tissue: Callus, score: 92.01 N N N N
vg0323622322 A -> G LOC_Os03g42464.1 downstream_gene_variant ; 1142.0bp to feature; MODIFIER silent_mutation Average:72.182; most accessible tissue: Callus, score: 92.01 N N N N
vg0323622322 A -> G LOC_Os03g42450-LOC_Os03g42464 intergenic_region ; MODIFIER silent_mutation Average:72.182; most accessible tissue: Callus, score: 92.01 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0323622322 A G -0.08 -0.04 -0.02 0.0 -0.07 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323622322 7.64E-06 NA Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323622322 NA 7.28E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 6.94E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 5.48E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 5.48E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 4.60E-07 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 1.15E-33 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 5.92E-06 5.92E-06 mr1674 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 5.99E-06 8.94E-120 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 4.53E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 1.04E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 2.03E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 1.26E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 4.14E-07 mr1886 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 1.04E-07 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 4.77E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 NA 1.78E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323622322 4.36E-06 3.13E-48 mr1670_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251