\
| Variant ID: vg0323603573 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23603573 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 116. )
CAATTGGCTTCGAAAGTGGGGGCATGGATGCAATTATCCCTTTTTGTTTTTCTTCTCTCTTATACTGGGTCTCCCGTCAGCTTTTAAAATATAGATAGAT[A/G]
GATTAAATGATCATTCTACTCTTTTACATATACCCCATAATAAATAAAAAGAAAAAAAAGATGACAGGCCAGCCAACATTGTTTCTATCTTTCCCTTAAA
TTTAAGGGAAAGATAGAAACAATGTTGGCTGGCCTGTCATCTTTTTTTTCTTTTTATTTATTATGGGGTATATGTAAAAGAGTAGAATGATCATTTAATC[T/C]
ATCTATCTATATTTTAAAAGCTGACGGGAGACCCAGTATAAGAGAGAAGAAAAACAAAAAGGGATAATTGCATCCATGCCCCCACTTTCGAAGCCAATTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.20% | 48.50% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 20.40% | 79.20% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 77.70% | 22.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 30.90% | 68.40% | 0.67% | 0.00% | NA |
| Indica II | 465 | 18.90% | 80.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 11.00% | 88.70% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 24.30% | 75.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 38.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323603573 | A -> G | LOC_Os03g42410-LOC_Os03g42420 | intergenic_region ; MODIFIER | silent_mutation | Average:56.693; most accessible tissue: Callus, score: 83.577 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323603573 | NA | 1.11E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 2.31E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 3.20E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | 2.32E-06 | NA | mr1106 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 2.00E-06 | mr1106 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 6.09E-12 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 9.48E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 3.14E-13 | mr1329 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 2.53E-06 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 7.30E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 3.76E-09 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 1.24E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323603573 | NA | 9.35E-08 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |