\
| Variant ID: vg0323548805 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23548805 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 117. )
CCAGTCTGTGACCGGCCTGACACCGGTCACGTCTGACTGGACAGACAACCGTGCTCCCATGTCGCATCTGCCTCCGGCGGAGTGGAGGTAGGTATGACCC[G/A]
TTCCATCGGAGGGTCATTCGGAGGGCGGCCACCACAAGTCTTCACCCATTAATGAGGGAATGACAGGGCTGTCCCCCGTGTCAGGCGAGGGACGGCGCTG
CAGCGCCGTCCCTCGCCTGACACGGGGGACAGCCCTGTCATTCCCTCATTAATGGGTGAAGACTTGTGGTGGCCGCCCTCCGAATGACCCTCCGATGGAA[C/T]
GGGTCATACCTACCTCCACTCCGCCGGAGGCAGATGCGACATGGGAGCACGGTTGTCTGTCCAGTCAGACGTGACCGGTGTCAGGCCGGTCACAGACTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 39.80% | 2.98% | 1.42% | NA |
| All Indica | 2759 | 85.50% | 8.20% | 4.53% | 1.74% | NA |
| All Japonica | 1512 | 0.50% | 99.40% | 0.07% | 0.07% | NA |
| Aus | 269 | 85.10% | 3.70% | 5.58% | 5.58% | NA |
| Indica I | 595 | 90.10% | 1.80% | 6.89% | 1.18% | NA |
| Indica II | 465 | 84.30% | 10.50% | 4.73% | 0.43% | NA |
| Indica III | 913 | 82.70% | 11.20% | 3.29% | 2.85% | NA |
| Indica Intermediate | 786 | 86.10% | 8.10% | 4.07% | 1.65% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 98.80% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 54.40% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323548805 | G -> A | LOC_Os03g42320.1 | upstream_gene_variant ; 1137.0bp to feature; MODIFIER | silent_mutation | Average:50.549; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 | N | N | N | N |
| vg0323548805 | G -> A | LOC_Os03g42320-LOC_Os03g42334 | intergenic_region ; MODIFIER | silent_mutation | Average:50.549; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 | N | N | N | N |
| vg0323548805 | G -> DEL | N | N | silent_mutation | Average:50.549; most accessible tissue: Zhenshan97 flag leaf, score: 85.88 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323548805 | NA | 2.12E-28 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 2.12E-39 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 2.99E-19 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 7.76E-14 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 2.81E-115 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 8.27E-06 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 1.98E-54 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 3.29E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 6.29E-55 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | 4.37E-06 | 5.07E-06 | mr1197_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 3.60E-19 | mr1336_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 1.99E-23 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323548805 | NA | 1.33E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |