\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323531922:

Variant ID: vg0323531922 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23531922
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AATATTCTATATCAACAACTCGACTCCTTCTCTTACATTTGAATAGAGTTCGAGGGCTAAGTAAGTTTGGTGGGGCCCACCATACATCAAGTCCTATATG[G/A]
AATCAAGCCTCATACGTATGGGAAAAGTCCTGAGTAGATAAAAAGAAAAGTTTCGGATAAGAAAATAACATAGTCCTGTTTAGGCCCAAACTAATTTTAC

Reverse complement sequence

GTAAAATTAGTTTGGGCCTAAACAGGACTATGTTATTTTCTTATCCGAAACTTTTCTTTTTATCTACTCAGGACTTTTCCCATACGTATGAGGCTTGATT[C/T]
CATATAGGACTTGATGTATGGTGGGCCCCACCAAACTTACTTAGCCCTCGAACTCTATTCAAATGTAAGAGAAGGAGTCGAGTTGTTGATATAGAATATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 9.70% 0.91% 0.00% NA
All Indica  2759 99.70% 0.30% 0.04% 0.00% NA
All Japonica  1512 72.80% 24.60% 2.58% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.13% 0.00% NA
Temperate Japonica  767 95.60% 2.20% 2.22% 0.00% NA
Tropical Japonica  504 37.10% 59.70% 3.17% 0.00% NA
Japonica Intermediate  241 75.10% 22.40% 2.49% 0.00% NA
VI/Aromatic  96 32.30% 66.70% 1.04% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323531922 G -> A LOC_Os03g42284.1 upstream_gene_variant ; 1320.0bp to feature; MODIFIER silent_mutation Average:50.172; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0323531922 G -> A LOC_Os03g42290.1 upstream_gene_variant ; 1541.0bp to feature; MODIFIER silent_mutation Average:50.172; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0323531922 G -> A LOC_Os03g42280.1 downstream_gene_variant ; 3607.0bp to feature; MODIFIER silent_mutation Average:50.172; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0323531922 G -> A LOC_Os03g42280.2 downstream_gene_variant ; 3607.0bp to feature; MODIFIER silent_mutation Average:50.172; most accessible tissue: Minghui63 root, score: 88.578 N N N N
vg0323531922 G -> A LOC_Os03g42284-LOC_Os03g42290 intergenic_region ; MODIFIER silent_mutation Average:50.172; most accessible tissue: Minghui63 root, score: 88.578 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0323531922 G A -0.03 -0.02 -0.02 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323531922 2.29E-06 NA Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323531922 NA 8.19E-15 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323531922 1.43E-08 NA Grain_width All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323531922 NA 3.68E-15 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0323531922 NA 7.57E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 4.75E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 7.22E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 7.81E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 5.22E-09 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 3.37E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 9.66E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 2.64E-07 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 5.19E-13 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 4.37E-10 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 5.38E-06 mr1388_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 3.77E-10 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 1.57E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 1.81E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 1.69E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323531922 NA 1.51E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251