\
| Variant ID: vg0323497027 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23497027 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGTCGTTGTGCAGGTGGTGAATATCGAAGGTATCCTCGGTGTGTAGGTGACATTTAGTGGCTCCCGTCGTGGATGCTATGGTTGATGGGTGCTCCAAGG[C/T]
GAAAGTCTTGCTCCGCTCTCGGTGCTAGCAACGGCGACGCCCTTGGGCACCGTTCACCTTCTTGAAGGCGTTGCTACTGGAGCCCTCGTTCAACTCCACT
AGTGGAGTTGAACGAGGGCTCCAGTAGCAACGCCTTCAAGAAGGTGAACGGTGCCCAAGGGCGTCGCCGTTGCTAGCACCGAGAGCGGAGCAAGACTTTC[G/A]
CCTTGGAGCACCCATCAACCATAGCATCCACGACGGGAGCCACTAAATGTCACCTACACACCGAGGATACCTTCGATATTCACCACCTGCACAACGACCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 5.60% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 14.90% | 85.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 3.10% | 12.50% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323497027 | C -> T | LOC_Os03g42235.1 | 3_prime_UTR_variant ; 43.0bp to feature; MODIFIER | silent_mutation | Average:51.759; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0323497027 | C -> T | LOC_Os03g42240.1 | upstream_gene_variant ; 2408.0bp to feature; MODIFIER | silent_mutation | Average:51.759; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| vg0323497027 | C -> T | LOC_Os03g42230.1 | downstream_gene_variant ; 703.0bp to feature; MODIFIER | silent_mutation | Average:51.759; most accessible tissue: Zhenshan97 panicle, score: 82.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323497027 | NA | 3.72E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 1.77E-06 | mr1184 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 1.08E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 2.47E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 3.83E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 9.63E-06 | mr1424 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 5.16E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 5.56E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 2.15E-19 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 9.58E-07 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 7.62E-12 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 3.60E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 1.87E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 7.47E-07 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 2.66E-06 | mr1787 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 1.61E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 5.89E-10 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | 5.07E-06 | 9.64E-11 | mr1808_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323497027 | NA | 1.56E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |