Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323497027:

Variant ID: vg0323497027 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23497027
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGTCGTTGTGCAGGTGGTGAATATCGAAGGTATCCTCGGTGTGTAGGTGACATTTAGTGGCTCCCGTCGTGGATGCTATGGTTGATGGGTGCTCCAAGG[C/T]
GAAAGTCTTGCTCCGCTCTCGGTGCTAGCAACGGCGACGCCCTTGGGCACCGTTCACCTTCTTGAAGGCGTTGCTACTGGAGCCCTCGTTCAACTCCACT

Reverse complement sequence

AGTGGAGTTGAACGAGGGCTCCAGTAGCAACGCCTTCAAGAAGGTGAACGGTGCCCAAGGGCGTCGCCGTTGCTAGCACCGAGAGCGGAGCAAGACTTTC[G/A]
CCTTGGAGCACCCATCAACCATAGCATCCACGACGGGAGCCACTAAATGTCACCTACACACCGAGGATACCTTCGATATTCACCACCTGCACAACGACCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.60%	0.32%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.13%	0.00%	NA
Aus	269	14.90%	85.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	97.10%	2.90%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	84.40%	3.10%	12.50%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323497027	C -> T	LOC_Os03g42235.1	3_prime_UTR_variant ; 43.0bp to feature; MODIFIER	silent_mutation	Average:51.759; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0323497027	C -> T	LOC_Os03g42240.1	upstream_gene_variant ; 2408.0bp to feature; MODIFIER	silent_mutation	Average:51.759; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N
vg0323497027	C -> T	LOC_Os03g42230.1	downstream_gene_variant ; 703.0bp to feature; MODIFIER	silent_mutation	Average:51.759; most accessible tissue: Zhenshan97 panicle, score: 82.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323497027	NA	3.72E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	1.77E-06	mr1184	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	1.08E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	2.47E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	3.83E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	9.63E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	5.16E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	5.56E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	2.15E-19	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	9.58E-07	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	7.62E-12	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	3.60E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	1.87E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	7.47E-07	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	2.66E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	1.61E-06	mr1808	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	5.89E-10	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	5.07E-06	9.64E-11	mr1808_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323497027	NA	1.56E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251