Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323468119:

Variant ID: vg0323468119 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23468119
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

TGCATAGATCGACGAGATGTACAATCCTTGAATGATTGATTACGGTTTTATATACGACGCCATTGTTATGTACTCTGCTCATGCATCTTCTCCTGCTCTA[C/T]
AATTCTAAGTTGTTCATGTCACAGTTTCGCTAGAATTGGCAAGACTAGAGAAGCTGAGTAGCTGACCAATACCCAGCCACAAAACTGCTAGCAGCAAAAT

Reverse complement sequence

ATTTTGCTGCTAGCAGTTTTGTGGCTGGGTATTGGTCAGCTACTCAGCTTCTCTAGTCTTGCCAATTCTAGCGAAACTGTGACATGAACAACTTAGAATT[G/A]
TAGAGCAGGAGAAGATGCATGAGCAGAGTACATAACAATGGCGTCGTATATAAAACCGTAATCAATCATTCAAGGATTGTACATCTCGTCGATCTATGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	7.30%	3.47%	0.00%	NA
All Indica	2759	89.60%	10.00%	0.47%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	21.60%	22.70%	55.76%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	90.80%	8.80%	0.43%	0.00%	NA
Indica III	913	82.30%	17.60%	0.11%	0.00%	NA
Indica Intermediate	786	89.90%	8.80%	1.27%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323468119	C -> T	LOC_Os03g42180.1	upstream_gene_variant ; 4818.0bp to feature; MODIFIER	silent_mutation	Average:60.236; most accessible tissue: Callus, score: 74.506	N	N	N	N
vg0323468119	C -> T	LOC_Os03g42190.1	upstream_gene_variant ; 1666.0bp to feature; MODIFIER	silent_mutation	Average:60.236; most accessible tissue: Callus, score: 74.506	N	N	N	N
vg0323468119	C -> T	LOC_Os03g42200.1	downstream_gene_variant ; 4159.0bp to feature; MODIFIER	silent_mutation	Average:60.236; most accessible tissue: Callus, score: 74.506	N	N	N	N
vg0323468119	C -> T	LOC_Os03g42190-LOC_Os03g42200	intergenic_region ; MODIFIER	silent_mutation	Average:60.236; most accessible tissue: Callus, score: 74.506	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323468119	NA	1.84E-06	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	2.82E-08	mr1139	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	9.31E-08	mr1226	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	1.40E-08	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	3.90E-09	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	1.27E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	5.68E-06	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	1.98E-11	mr1070_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	1.89E-08	mr1088_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	2.12E-07	mr1233_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	5.63E-06	mr1246_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	7.07E-08	mr1264_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	6.31E-06	mr1404_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	8.40E-13	mr1437_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	2.20E-07	mr1620_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	4.72E-06	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	2.55E-13	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119	NA	5.36E-08	mr1949_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251