\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323468119:

Variant ID: vg0323468119 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23468119
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


TGCATAGATCGACGAGATGTACAATCCTTGAATGATTGATTACGGTTTTATATACGACGCCATTGTTATGTACTCTGCTCATGCATCTTCTCCTGCTCTA[C/T]
AATTCTAAGTTGTTCATGTCACAGTTTCGCTAGAATTGGCAAGACTAGAGAAGCTGAGTAGCTGACCAATACCCAGCCACAAAACTGCTAGCAGCAAAAT

Reverse complement sequence

ATTTTGCTGCTAGCAGTTTTGTGGCTGGGTATTGGTCAGCTACTCAGCTTCTCTAGTCTTGCCAATTCTAGCGAAACTGTGACATGAACAACTTAGAATT[G/A]
TAGAGCAGGAGAAGATGCATGAGCAGAGTACATAACAATGGCGTCGTATATAAAACCGTAATCAATCATTCAAGGATTGTACATCTCGTCGATCTATGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 7.30% 3.47% 0.00% NA
All Indica  2759 89.60% 10.00% 0.47% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 21.60% 22.70% 55.76% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 90.80% 8.80% 0.43% 0.00% NA
Indica III  913 82.30% 17.60% 0.11% 0.00% NA
Indica Intermediate  786 89.90% 8.80% 1.27% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323468119 C -> T LOC_Os03g42180.1 upstream_gene_variant ; 4818.0bp to feature; MODIFIER silent_mutation Average:60.236; most accessible tissue: Callus, score: 74.506 N N N N
vg0323468119 C -> T LOC_Os03g42190.1 upstream_gene_variant ; 1666.0bp to feature; MODIFIER silent_mutation Average:60.236; most accessible tissue: Callus, score: 74.506 N N N N
vg0323468119 C -> T LOC_Os03g42200.1 downstream_gene_variant ; 4159.0bp to feature; MODIFIER silent_mutation Average:60.236; most accessible tissue: Callus, score: 74.506 N N N N
vg0323468119 C -> T LOC_Os03g42190-LOC_Os03g42200 intergenic_region ; MODIFIER silent_mutation Average:60.236; most accessible tissue: Callus, score: 74.506 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323468119 NA 1.84E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 2.82E-08 mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 9.31E-08 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 1.40E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 3.90E-09 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 1.27E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 5.68E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 1.98E-11 mr1070_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 1.89E-08 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 2.12E-07 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 5.63E-06 mr1246_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 7.07E-08 mr1264_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 6.31E-06 mr1404_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 8.40E-13 mr1437_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 2.20E-07 mr1620_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 4.72E-06 mr1676_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 2.55E-13 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323468119 NA 5.36E-08 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251