\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323240599:

Variant ID: vg0323240599 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 23240599
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAGTCCTTTTTCCTTCACTCTTGTTTTTGTTTTTTTTTGTGTCCAATAAAGCCTAGCAGATACAAAGACAAGTGTGGGGGGGTGATCTTGCACATTAA[C/T]
GGCATAACAAAAGCAAGATCACCCCAGAAGTGATGAGCCATGATGAACCACACATGGAAAATTGATGCAGTCAGACCTAATGAGGGGTCTGCCAAACCTC

Reverse complement sequence

GAGGTTTGGCAGACCCCTCATTAGGTCTGACTGCATCAATTTTCCATGTGTGGTTCATCATGGCTCATCACTTCTGGGGTGATCTTGCTTTTGTTATGCC[G/A]
TTAATGTGCAAGATCACCCCCCCACACTTGTCTTTGTATCTGCTAGGCTTTATTGGACACAAAAAAAAACAAAAACAAGAGTGAAGGAAAAAGGACTCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.10% 5.40% 0.70% 1.78% NA
All Indica  2759 95.00% 0.90% 1.12% 2.97% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 16.40% 83.30% 0.37% 0.00% NA
Indica I  595 98.70% 0.00% 0.17% 1.18% NA
Indica II  465 98.90% 0.00% 0.00% 1.08% NA
Indica III  913 92.60% 0.40% 2.30% 4.71% NA
Indica Intermediate  786 92.60% 2.80% 1.15% 3.44% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0323240599 C -> T LOC_Os03g41840.1 upstream_gene_variant ; 4845.0bp to feature; MODIFIER silent_mutation Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0323240599 C -> T LOC_Os03g41850.1 upstream_gene_variant ; 191.0bp to feature; MODIFIER silent_mutation Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0323240599 C -> T LOC_Os03g41860.1 downstream_gene_variant ; 3734.0bp to feature; MODIFIER silent_mutation Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0323240599 C -> T LOC_Os03g41850-LOC_Os03g41860 intergenic_region ; MODIFIER silent_mutation Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0323240599 C -> DEL N N silent_mutation Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0323240599 NA 3.79E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 7.89E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 7.65E-07 3.26E-13 mr1471 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 6.85E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 1.07E-24 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 1.36E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 2.93E-08 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 6.70E-11 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 1.52E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 6.70E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 4.81E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 1.87E-11 mr1047_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 4.51E-06 NA mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 4.07E-11 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 1.30E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 4.23E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 7.04E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 3.85E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 3.22E-09 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599 NA 1.88E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251