Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323240599:

Variant ID: vg0323240599 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 23240599
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGAGTCCTTTTTCCTTCACTCTTGTTTTTGTTTTTTTTTGTGTCCAATAAAGCCTAGCAGATACAAAGACAAGTGTGGGGGGGTGATCTTGCACATTAA[C/T]
GGCATAACAAAAGCAAGATCACCCCAGAAGTGATGAGCCATGATGAACCACACATGGAAAATTGATGCAGTCAGACCTAATGAGGGGTCTGCCAAACCTC

Reverse complement sequence

GAGGTTTGGCAGACCCCTCATTAGGTCTGACTGCATCAATTTTCCATGTGTGGTTCATCATGGCTCATCACTTCTGGGGTGATCTTGCTTTTGTTATGCC[G/A]
TTAATGTGCAAGATCACCCCCCCACACTTGTCTTTGTATCTGCTAGGCTTTATTGGACACAAAAAAAAACAAAAACAAGAGTGAAGGAAAAAGGACTCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.10%	5.40%	0.70%	1.78%	NA
All Indica	2759	95.00%	0.90%	1.12%	2.97%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	16.40%	83.30%	0.37%	0.00%	NA
Indica I	595	98.70%	0.00%	0.17%	1.18%	NA
Indica II	465	98.90%	0.00%	0.00%	1.08%	NA
Indica III	913	92.60%	0.40%	2.30%	4.71%	NA
Indica Intermediate	786	92.60%	2.80%	1.15%	3.44%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	93.30%	3.30%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323240599	C -> T	LOC_Os03g41840.1	upstream_gene_variant ; 4845.0bp to feature; MODIFIER	silent_mutation	Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0323240599	C -> T	LOC_Os03g41850.1	upstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0323240599	C -> T	LOC_Os03g41860.1	downstream_gene_variant ; 3734.0bp to feature; MODIFIER	silent_mutation	Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0323240599	C -> T	LOC_Os03g41850-LOC_Os03g41860	intergenic_region ; MODIFIER	silent_mutation	Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N
vg0323240599	C -> DEL	N	N	silent_mutation	Average:37.413; most accessible tissue: Zhenshan97 flag leaf, score: 49.013	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323240599	NA	3.79E-13	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	7.89E-06	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	7.65E-07	3.26E-13	mr1471	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	6.85E-19	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	1.07E-24	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	1.36E-11	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	2.93E-08	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	6.70E-11	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	1.52E-07	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	6.70E-06	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	4.81E-10	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	1.87E-11	mr1047_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	4.51E-06	NA	mr1134_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	4.07E-11	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	1.30E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	4.23E-08	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	7.04E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	3.85E-08	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	3.22E-09	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323240599	NA	1.88E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251