| Variant ID: vg0323177575 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 23177575 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCCTCAGCCCATCGGGACAGTCGAGTCACCATCGGGTTGTAGCAGCAAGGTGTATCCTAGACTTTGTAGACATAGTTGCTCTCCTCCCGAAACGGATGGT[A/G]
AGCAAAGTCGGTACTTGCCAACTCAGCTCGGTGAATAGAGCTACGTCGGAGGAAGGCCTCCCGGGCTGCGTCCTGCATCGCGGTCTCTGTAAGTCGCGAC
GTCGCGACTTACAGAGACCGCGATGCAGGACGCAGCCCGGGAGGCCTTCCTCCGACGTAGCTCTATTCACCGAGCTGAGTTGGCAAGTACCGACTTTGCT[T/C]
ACCATCCGTTTCGGGAGGAGAGCAACTATGTCTACAAAGTCTAGGATACACCTTGCTGCTACAACCCGATGGTGACTCGACTGTCCCGATGGGCTGAGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.90% | 27.70% | 4.21% | 1.23% | NA |
| All Indica | 2759 | 93.00% | 1.30% | 3.73% | 2.03% | NA |
| All Japonica | 1512 | 15.50% | 78.70% | 5.75% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 96.30% | 1.30% | 1.68% | 0.67% | NA |
| Indica II | 465 | 97.80% | 0.20% | 1.08% | 0.86% | NA |
| Indica III | 913 | 91.00% | 0.40% | 5.59% | 2.96% | NA |
| Indica Intermediate | 786 | 89.80% | 2.80% | 4.71% | 2.67% | NA |
| Temperate Japonica | 767 | 20.10% | 70.70% | 9.26% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 93.30% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 20.70% | 73.90% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 52.10% | 47.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 38.90% | 7.78% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0323177575 | A -> DEL | N | N | silent_mutation | Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| vg0323177575 | A -> G | LOC_Os03g41710.1 | upstream_gene_variant ; 1260.0bp to feature; MODIFIER | silent_mutation | Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| vg0323177575 | A -> G | LOC_Os03g41720.1 | upstream_gene_variant ; 69.0bp to feature; MODIFIER | silent_mutation | Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| vg0323177575 | A -> G | LOC_Os03g41720-LOC_Os03g41740 | intergenic_region ; MODIFIER | silent_mutation | Average:59.303; most accessible tissue: Minghui63 young leaf, score: 78.054 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0323177575 | NA | 2.20E-15 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323177575 | NA | 6.03E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323177575 | 3.99E-06 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323177575 | NA | 1.11E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323177575 | NA | 1.34E-10 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323177575 | NA | 2.82E-08 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323177575 | 4.91E-06 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323177575 | NA | 1.65E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323177575 | NA | 6.87E-14 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0323177575 | 6.37E-08 | NA | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/