Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0323047220:

Variant ID: vg0323047220 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 23047220
Reference Allele: CCT	Alternative Allele: C,ACT
Primary Allele: ACT	Secondary Allele: CCT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTAGAGATGATGGGATCAAGTGGCTAAGATAAGGCTCTGATACCACAATGTTGGAATTTAATCCAATTAATTGATTGAGTCTTAGCCTAAACATGATAA[CCT/C,ACT]
CTGCTTAATTATGCTTAATTATGCGGAAATTGATCTAGCTGAACTAAGATGAAGCCATTGTCCTTCTTTCTTCTTCTTTGTGTTCTTCAGTTGTGAGATA

Reverse complement sequence

TATCTCACAACTGAAGAACACAAAGAAGAAGAAAGAAGGACAATGGCTTCATCTTAGTTCAGCTAGATCAATTTCCGCATAATTAAGCATAATTAAGCAG[AGG/G,AGT]
TTATCATGTTTAGGCTAAGACTCAATCAATTAATTGGATTAAATTCCAACATTGTGGTATCAGAGCCTTATCTTAGCCACTTGATCCCATCATCTCTAAG

Allele Frequencies:

Populations	Population Size	Frequency of ACT(primary allele)	Frequency of CCT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	42.10%	0.44%	0.08%	C: 7.66%
All Indica	2759	82.00%	4.50%	0.43%	0.11%	C: 12.98%
All Japonica	1512	0.70%	99.00%	0.20%	0.07%	NA
Aus	269	14.10%	84.80%	0.74%	0.00%	C: 0.37%
Indica I	595	48.70%	5.90%	1.01%	0.34%	C: 44.03%
Indica II	465	96.30%	0.90%	0.43%	0.00%	C: 2.37%
Indica III	913	95.00%	4.70%	0.22%	0.00%	C: 0.11%
Indica Intermediate	786	83.60%	5.30%	0.25%	0.13%	C: 10.69%
Temperate Japonica	767	0.40%	99.50%	0.00%	0.13%	NA
Tropical Japonica	504	1.40%	98.40%	0.20%	0.00%	NA
Japonica Intermediate	241	0.40%	98.80%	0.83%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	38.90%	53.30%	4.44%	0.00%	C: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0323047220	CCT -> C	LOC_Os03g41419.1	upstream_gene_variant ; 1001.0bp to feature; MODIFIER	silent_mutation	Average:71.932; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0323047220	CCT -> C	LOC_Os03g41400.1	downstream_gene_variant ; 279.0bp to feature; MODIFIER	silent_mutation	Average:71.932; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0323047220	CCT -> C	LOC_Os03g41400-LOC_Os03g41419	intergenic_region ; MODIFIER	silent_mutation	Average:71.932; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0323047220	CCT -> DEL	N	N	silent_mutation	Average:71.932; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0323047220	CCT -> ACT	LOC_Os03g41419.1	upstream_gene_variant ; 1002.0bp to feature; MODIFIER	silent_mutation	Average:71.932; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0323047220	CCT -> ACT	LOC_Os03g41400.1	downstream_gene_variant ; 278.0bp to feature; MODIFIER	silent_mutation	Average:71.932; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N
vg0323047220	CCT -> ACT	LOC_Os03g41400-LOC_Os03g41419	intergenic_region ; MODIFIER	silent_mutation	Average:71.932; most accessible tissue: Minghui63 flower, score: 80.815	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0323047220	NA	2.73E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323047220	3.37E-06	3.37E-06	mr1102	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323047220	NA	5.07E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323047220	NA	4.30E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323047220	NA	3.17E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323047220	NA	2.94E-11	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0323047220	NA	2.18E-13	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251