\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322883878:

Variant ID: vg0322883878 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22883878
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, C: 0.17, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


AAATCTTCCTGGGCCACTAGCTAGCTCAAGCATATCCTGACCTTTTCCTTTCTCATATAGACTAAAATCCAACATAAACCATTCTATTTTATACATGTAA[T/C]
TTTATCCGTATAAACTTTACATATACCTTTATGCATAGTAATTTTCAGTAGGTTTTTATATATAAGCTTTACACATGTAAACTTTCAACATAGATTTTTT

Reverse complement sequence

AAAAAATCTATGTTGAAAGTTTACATGTGTAAAGCTTATATATAAAAACCTACTGAAAATTACTATGCATAAAGGTATATGTAAAGTTTATACGGATAAA[A/G]
TTACATGTATAAAATAGAATGGTTTATGTTGGATTTTAGTCTATATGAGAAAGGAAAAGGTCAGGATATGCTTGAGCTAGCTAGTGGCCCAGGAAGATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.10% 18.50% 0.38% 0.00% NA
All Indica  2759 77.20% 22.70% 0.11% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 15.20% 84.80% 0.00% 0.00% NA
Indica I  595 48.10% 51.90% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 88.40% 11.60% 0.00% 0.00% NA
Indica Intermediate  786 75.40% 24.20% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 80.20% 6.20% 13.54% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322883878 T -> C LOC_Os03g41154.1 upstream_gene_variant ; 1251.0bp to feature; MODIFIER silent_mutation Average:77.418; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0322883878 T -> C LOC_Os03g41160.1 upstream_gene_variant ; 922.0bp to feature; MODIFIER silent_mutation Average:77.418; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0322883878 T -> C LOC_Os03g41150.1 downstream_gene_variant ; 3424.0bp to feature; MODIFIER silent_mutation Average:77.418; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N
vg0322883878 T -> C LOC_Os03g41154-LOC_Os03g41160 intergenic_region ; MODIFIER silent_mutation Average:77.418; most accessible tissue: Minghui63 panicle, score: 91.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0322883878 T C -0.13 -0.11 -0.09 -0.05 -0.06 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322883878 NA 7.74E-08 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322883878 NA 4.61E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 5.83E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 3.54E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 6.51E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 8.54E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 7.26E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 8.85E-07 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 3.79E-12 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 2.21E-07 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 8.96E-06 8.97E-06 mr1459 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 3.68E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 3.31E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 1.48E-08 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 5.40E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 2.67E-07 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 4.35E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 1.51E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 1.26E-13 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 9.46E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 3.01E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322883878 NA 2.79E-08 mr1985 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251