\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322820996:

Variant ID: vg0322820996 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22820996
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAAAATGTTTCAATCGTTTAAAAGGCTGAAACACAACCAAATCACCTTATGAAATATTTTGCTAGAACGTATGAAACAACGGTTTTTTAAATATGTTT[C/T]
ACCATATATAAAAACAATGTTTCAGCAAATAGCGAAAGAATATTGCAATTTACTACAACATTTTATCTATACATAGTGAAACAACACGAGTATACTTGCT

Reverse complement sequence

AGCAAGTATACTCGTGTTGTTTCACTATGTATAGATAAAATGTTGTAGTAAATTGCAATATTCTTTCGCTATTTGCTGAAACATTGTTTTTATATATGGT[G/A]
AAACATATTTAAAAAACCGTTGTTTCATACGTTCTAGCAAAATATTTCATAAGGTGATTTGGTTGTGTTTCAGCCTTTTAAACGATTGAAACATTTTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.60% 0.80% 1.74% 61.81% NA
All Indica  2759 3.50% 0.30% 1.92% 94.31% NA
All Japonica  1512 96.60% 2.10% 0.73% 0.60% NA
Aus  269 2.20% 0.00% 0.00% 97.77% NA
Indica I  595 4.90% 0.20% 0.67% 94.29% NA
Indica II  465 3.20% 1.10% 0.43% 95.27% NA
Indica III  913 1.20% 0.00% 3.18% 95.62% NA
Indica Intermediate  786 5.30% 0.10% 2.29% 92.24% NA
Temperate Japonica  767 94.30% 4.20% 1.30% 0.26% NA
Tropical Japonica  504 98.80% 0.00% 0.00% 1.19% NA
Japonica Intermediate  241 99.20% 0.00% 0.41% 0.41% NA
VI/Aromatic  96 77.10% 0.00% 16.67% 6.25% NA
Intermediate  90 52.20% 0.00% 2.22% 45.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322820996 C -> T LOC_Os03g41050.1 upstream_gene_variant ; 4528.0bp to feature; MODIFIER silent_mutation Average:18.579; most accessible tissue: Callus, score: 52.368 N N N N
vg0322820996 C -> T LOC_Os03g41060.1 upstream_gene_variant ; 3221.0bp to feature; MODIFIER silent_mutation Average:18.579; most accessible tissue: Callus, score: 52.368 N N N N
vg0322820996 C -> T LOC_Os03g41064.1 downstream_gene_variant ; 2776.0bp to feature; MODIFIER silent_mutation Average:18.579; most accessible tissue: Callus, score: 52.368 N N N N
vg0322820996 C -> T LOC_Os03g41070.1 downstream_gene_variant ; 4901.0bp to feature; MODIFIER silent_mutation Average:18.579; most accessible tissue: Callus, score: 52.368 N N N N
vg0322820996 C -> T LOC_Os03g41060-LOC_Os03g41064 intergenic_region ; MODIFIER silent_mutation Average:18.579; most accessible tissue: Callus, score: 52.368 N N N N
vg0322820996 C -> DEL N N silent_mutation Average:18.579; most accessible tissue: Callus, score: 52.368 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322820996 1.67E-09 2.49E-10 mr1210 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996 5.87E-08 2.12E-09 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996 1.06E-09 2.06E-11 mr1585 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996 4.06E-09 3.75E-10 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996 NA 2.56E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996 1.31E-08 3.49E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996 2.02E-08 1.22E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251