Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322820996:

Variant ID: vg0322820996 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22820996
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

TCAAAAATGTTTCAATCGTTTAAAAGGCTGAAACACAACCAAATCACCTTATGAAATATTTTGCTAGAACGTATGAAACAACGGTTTTTTAAATATGTTT[C/T]
ACCATATATAAAAACAATGTTTCAGCAAATAGCGAAAGAATATTGCAATTTACTACAACATTTTATCTATACATAGTGAAACAACACGAGTATACTTGCT

Reverse complement sequence

AGCAAGTATACTCGTGTTGTTTCACTATGTATAGATAAAATGTTGTAGTAAATTGCAATATTCTTTCGCTATTTGCTGAAACATTGTTTTTATATATGGT[G/A]
AAACATATTTAAAAAACCGTTGTTTCATACGTTCTAGCAAAATATTTCATAAGGTGATTTGGTTGTGTTTCAGCCTTTTAAACGATTGAAACATTTTTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.60%	0.80%	1.74%	61.81%	NA
All Indica	2759	3.50%	0.30%	1.92%	94.31%	NA
All Japonica	1512	96.60%	2.10%	0.73%	0.60%	NA
Aus	269	2.20%	0.00%	0.00%	97.77%	NA
Indica I	595	4.90%	0.20%	0.67%	94.29%	NA
Indica II	465	3.20%	1.10%	0.43%	95.27%	NA
Indica III	913	1.20%	0.00%	3.18%	95.62%	NA
Indica Intermediate	786	5.30%	0.10%	2.29%	92.24%	NA
Temperate Japonica	767	94.30%	4.20%	1.30%	0.26%	NA
Tropical Japonica	504	98.80%	0.00%	0.00%	1.19%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.41%	NA
VI/Aromatic	96	77.10%	0.00%	16.67%	6.25%	NA
Intermediate	90	52.20%	0.00%	2.22%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322820996	C -> T	LOC_Os03g41050.1	upstream_gene_variant ; 4528.0bp to feature; MODIFIER	silent_mutation	Average:18.579; most accessible tissue: Callus, score: 52.368	N	N	N	N
vg0322820996	C -> T	LOC_Os03g41060.1	upstream_gene_variant ; 3221.0bp to feature; MODIFIER	silent_mutation	Average:18.579; most accessible tissue: Callus, score: 52.368	N	N	N	N
vg0322820996	C -> T	LOC_Os03g41064.1	downstream_gene_variant ; 2776.0bp to feature; MODIFIER	silent_mutation	Average:18.579; most accessible tissue: Callus, score: 52.368	N	N	N	N
vg0322820996	C -> T	LOC_Os03g41070.1	downstream_gene_variant ; 4901.0bp to feature; MODIFIER	silent_mutation	Average:18.579; most accessible tissue: Callus, score: 52.368	N	N	N	N
vg0322820996	C -> T	LOC_Os03g41060-LOC_Os03g41064	intergenic_region ; MODIFIER	silent_mutation	Average:18.579; most accessible tissue: Callus, score: 52.368	N	N	N	N
vg0322820996	C -> DEL	N	N	silent_mutation	Average:18.579; most accessible tissue: Callus, score: 52.368	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322820996	1.67E-09	2.49E-10	mr1210	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996	5.87E-08	2.12E-09	mr1305	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996	1.06E-09	2.06E-11	mr1585	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996	4.06E-09	3.75E-10	mr1586	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996	NA	2.56E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996	1.31E-08	3.49E-09	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322820996	2.02E-08	1.22E-09	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251