\
| Variant ID: vg0322820996 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22820996 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )
TCAAAAATGTTTCAATCGTTTAAAAGGCTGAAACACAACCAAATCACCTTATGAAATATTTTGCTAGAACGTATGAAACAACGGTTTTTTAAATATGTTT[C/T]
ACCATATATAAAAACAATGTTTCAGCAAATAGCGAAAGAATATTGCAATTTACTACAACATTTTATCTATACATAGTGAAACAACACGAGTATACTTGCT
AGCAAGTATACTCGTGTTGTTTCACTATGTATAGATAAAATGTTGTAGTAAATTGCAATATTCTTTCGCTATTTGCTGAAACATTGTTTTTATATATGGT[G/A]
AAACATATTTAAAAAACCGTTGTTTCATACGTTCTAGCAAAATATTTCATAAGGTGATTTGGTTGTGTTTCAGCCTTTTAAACGATTGAAACATTTTTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.60% | 0.80% | 1.74% | 61.81% | NA |
| All Indica | 2759 | 3.50% | 0.30% | 1.92% | 94.31% | NA |
| All Japonica | 1512 | 96.60% | 2.10% | 0.73% | 0.60% | NA |
| Aus | 269 | 2.20% | 0.00% | 0.00% | 97.77% | NA |
| Indica I | 595 | 4.90% | 0.20% | 0.67% | 94.29% | NA |
| Indica II | 465 | 3.20% | 1.10% | 0.43% | 95.27% | NA |
| Indica III | 913 | 1.20% | 0.00% | 3.18% | 95.62% | NA |
| Indica Intermediate | 786 | 5.30% | 0.10% | 2.29% | 92.24% | NA |
| Temperate Japonica | 767 | 94.30% | 4.20% | 1.30% | 0.26% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 77.10% | 0.00% | 16.67% | 6.25% | NA |
| Intermediate | 90 | 52.20% | 0.00% | 2.22% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322820996 | C -> T | LOC_Os03g41050.1 | upstream_gene_variant ; 4528.0bp to feature; MODIFIER | silent_mutation | Average:18.579; most accessible tissue: Callus, score: 52.368 | N | N | N | N |
| vg0322820996 | C -> T | LOC_Os03g41060.1 | upstream_gene_variant ; 3221.0bp to feature; MODIFIER | silent_mutation | Average:18.579; most accessible tissue: Callus, score: 52.368 | N | N | N | N |
| vg0322820996 | C -> T | LOC_Os03g41064.1 | downstream_gene_variant ; 2776.0bp to feature; MODIFIER | silent_mutation | Average:18.579; most accessible tissue: Callus, score: 52.368 | N | N | N | N |
| vg0322820996 | C -> T | LOC_Os03g41070.1 | downstream_gene_variant ; 4901.0bp to feature; MODIFIER | silent_mutation | Average:18.579; most accessible tissue: Callus, score: 52.368 | N | N | N | N |
| vg0322820996 | C -> T | LOC_Os03g41060-LOC_Os03g41064 | intergenic_region ; MODIFIER | silent_mutation | Average:18.579; most accessible tissue: Callus, score: 52.368 | N | N | N | N |
| vg0322820996 | C -> DEL | N | N | silent_mutation | Average:18.579; most accessible tissue: Callus, score: 52.368 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322820996 | 1.67E-09 | 2.49E-10 | mr1210 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322820996 | 5.87E-08 | 2.12E-09 | mr1305 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322820996 | 1.06E-09 | 2.06E-11 | mr1585 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322820996 | 4.06E-09 | 3.75E-10 | mr1586 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322820996 | NA | 2.56E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322820996 | 1.31E-08 | 3.49E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322820996 | 2.02E-08 | 1.22E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |