| Variant ID: vg0322796391 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22796391 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AATCTGGGGTGACACCACAGGAAGAAATACATGGATCAAGCTCAGCACAATGAGCTACGACATGAGCTGCAACATTACATAACCGATTGACATGCACAAA[C/T]
GAACAAAATAAAAAACTAGAAACCATCATGTTGATATCACGGACAACACAACCAACAGAAGAACGATCCCTTGTCAACGATTGTGTAGGATCGAATCACA
TGTGATTCGATCCTACACAATCGTTGACAAGGGATCGTTCTTCTGTTGGTTGTGTTGTCCGTGATATCAACATGATGGTTTCTAGTTTTTTATTTTGTTC[G/A]
TTTGTGCATGTCAATCGGTTATGTAATGTTGCAGCTCATGTCGTAGCTCATTGTGCTGAGCTTGATCCATGTATTTCTTCCTGTGGTGTCACCCCAGATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.90% | 0.80% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.20% | 2.20% | 0.66% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.40% | 4.30% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322796391 | C -> T | LOC_Os03g41000.1 | upstream_gene_variant ; 2448.0bp to feature; MODIFIER | silent_mutation | Average:37.119; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0322796391 | C -> T | LOC_Os03g41010.1 | downstream_gene_variant ; 813.0bp to feature; MODIFIER | silent_mutation | Average:37.119; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0322796391 | C -> T | LOC_Os03g41000-LOC_Os03g41010 | intergenic_region ; MODIFIER | silent_mutation | Average:37.119; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322796391 | 3.97E-08 | 4.47E-10 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322796391 | 1.34E-07 | 1.04E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322796391 | 5.78E-08 | 2.49E-11 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322796391 | 2.48E-07 | 1.51E-09 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322796391 | 8.56E-06 | 1.07E-07 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322796391 | 6.92E-09 | 5.82E-10 | mr1305_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322796391 | 7.83E-06 | 3.12E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322796391 | 2.57E-06 | 7.93E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322796391 | 1.65E-09 | 1.98E-11 | mr1585_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |