\
| Variant ID: vg0322718664 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22718664 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )
TGAATCTCAGCAAGATAATCTCAACCGTTGAGTGATGAATGAAAGAATGAAGGAATGATTGAAACCATTTGTTGAACTATAGGGTAGAAGATCATTCGTC[C/T]
AGTATTTCTTAAAATAAAATCTTCAATTATATCTTCATAATTAATCATGTCCAAGATATCATTTTCAAGTGCTATTGTTGCAAGCAGCAAGCTATATCAC
GTGATATAGCTTGCTGCTTGCAACAATAGCACTTGAAAATGATATCTTGGACATGATTAATTATGAAGATATAATTGAAGATTTTATTTTAAGAAATACT[G/A]
GACGAATGATCTTCTACCCTATAGTTCAACAAATGGTTTCAATCATTCCTTCATTCTTTCATTCATCACTCAACGGTTGAGATTATCTTGCTGAGATTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.80% | 0.30% | 0.32% | 58.63% | NA |
| All Indica | 2759 | 2.50% | 0.40% | 0.36% | 96.74% | NA |
| All Japonica | 1512 | 99.30% | 0.00% | 0.07% | 0.60% | NA |
| Aus | 269 | 84.40% | 0.40% | 0.00% | 15.24% | NA |
| Indica I | 595 | 0.80% | 0.30% | 0.84% | 97.98% | NA |
| Indica II | 465 | 1.50% | 0.20% | 0.22% | 98.06% | NA |
| Indica III | 913 | 1.20% | 0.30% | 0.22% | 98.25% | NA |
| Indica Intermediate | 786 | 5.90% | 0.60% | 0.25% | 93.26% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 81.20% | 1.00% | 4.17% | 13.54% | NA |
| Intermediate | 90 | 56.70% | 0.00% | 0.00% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322718664 | C -> T | LOC_Os03g40870.1 | upstream_gene_variant ; 4349.0bp to feature; MODIFIER | silent_mutation | Average:70.505; most accessible tissue: Callus, score: 93.738 | N | N | N | N |
| vg0322718664 | C -> T | LOC_Os03g40860.1 | downstream_gene_variant ; 3257.0bp to feature; MODIFIER | silent_mutation | Average:70.505; most accessible tissue: Callus, score: 93.738 | N | N | N | N |
| vg0322718664 | C -> T | LOC_Os03g40840-LOC_Os03g40860 | intergenic_region ; MODIFIER | silent_mutation | Average:70.505; most accessible tissue: Callus, score: 93.738 | N | N | N | N |
| vg0322718664 | C -> DEL | N | N | silent_mutation | Average:70.505; most accessible tissue: Callus, score: 93.738 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322718664 | NA | 3.64E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322718664 | NA | 1.12E-07 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322718664 | 4.13E-08 | 2.29E-14 | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |