\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322677970:

Variant ID: vg0322677970 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22677970
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTTCTTTTTTTTCTTTTTCCTACTTTCGATTTTTTTCATTTTTATTCCAAATTTTAATCTCATATTGGATTCTTGTATGGACTCTTCTTTCAATTTT[T/C]
CTTATTTTTAATTCCGAATTTCAGTTATTTTAAAATTGTATTCCTACTACTTGGACTCTTCTCCTTTTTTTTTGCTAATTTTGGATTCTATTTTATTTTT

Reverse complement sequence

AAAAATAAAATAGAATCCAAAATTAGCAAAAAAAAAGGAGAAGAGTCCAAGTAGTAGGAATACAATTTTAAAATAACTGAAATTCGGAATTAAAAATAAG[A/G]
AAAATTGAAAGAAGAGTCCATACAAGAATCCAATATGAGATTAAAATTTGGAATAAAAATGAAAAAAATCGAAAGTAGGAAAAAGAAAAAAAAGAAGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 35.10% 0.17% 0.02% NA
All Indica  2759 98.40% 1.30% 0.25% 0.04% NA
All Japonica  1512 0.70% 99.30% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 97.60% 1.70% 0.65% 0.00% NA
Indica III  913 99.10% 0.50% 0.22% 0.11% NA
Indica Intermediate  786 97.50% 2.30% 0.25% 0.00% NA
Temperate Japonica  767 0.30% 99.60% 0.13% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 22.90% 77.10% 0.00% 0.00% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322677970 T -> C LOC_Os03g40780.1 upstream_gene_variant ; 2179.0bp to feature; MODIFIER silent_mutation Average:21.76; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0322677970 T -> C LOC_Os03g40780.2 upstream_gene_variant ; 2179.0bp to feature; MODIFIER silent_mutation Average:21.76; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0322677970 T -> C LOC_Os03g40780-LOC_Os03g40790 intergenic_region ; MODIFIER silent_mutation Average:21.76; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0322677970 T -> DEL N N silent_mutation Average:21.76; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322677970 NA 2.33E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 3.05E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.01E-25 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 2.90E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.74E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 8.92E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 5.73E-11 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.64E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.85E-10 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.70E-06 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 3.86E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.30E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 7.41E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 9.46E-08 mr1680 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.23E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.70E-06 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 6.69E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.41E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 9.14E-10 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 4.23E-10 mr1935 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 3.59E-10 mr1979 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322677970 NA 1.98E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251