\
| Variant ID: vg0322639869 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22639869 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCATAGAGAGGGATGTCCCCTCTTTACTTACATCTCATCTAAATAGTTATCAATTTTTTTAAATAAAATAACAACATATATTAATATAAAATATATATCA[C/A]
TCCATAAATATGCAGAGCAAATTTAACTTCTACAAGTTACAACGAAAAGAACAAAATAAACTGAAAATAGTTATCTATCGTACATTCGCAGCTATATTTG
CAAATATAGCTGCGAATGTACGATAGATAACTATTTTCAGTTTATTTTGTTCTTTTCGTTGTAACTTGTAGAAGTTAAATTTGCTCTGCATATTTATGGA[G/T]
TGATATATATTTTATATTAATATATGTTGTTATTTTATTTAAAAAAATTGATAACTATTTAGATGAGATGTAAGTAAAGAGGGGACATCCCTCTCTATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.90% | 5.00% | 9.75% | 28.33% | NA |
| All Indica | 2759 | 36.70% | 0.90% | 16.42% | 45.99% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Aus | 269 | 2.20% | 76.60% | 0.00% | 21.19% | NA |
| Indica I | 595 | 3.20% | 0.00% | 31.60% | 65.21% | NA |
| Indica II | 465 | 74.40% | 0.00% | 5.38% | 20.22% | NA |
| Indica III | 913 | 38.10% | 0.40% | 13.36% | 48.08% | NA |
| Indica Intermediate | 786 | 38.00% | 2.70% | 15.01% | 44.27% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 77.80% | 2.20% | 8.89% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322639869 | C -> A | LOC_Os03g40720.1 | downstream_gene_variant ; 1583.0bp to feature; MODIFIER | silent_mutation | Average:64.814; most accessible tissue: Zhenshan97 root, score: 81.564 | N | N | N | N |
| vg0322639869 | C -> A | LOC_Os03g40710.1 | intron_variant ; MODIFIER | silent_mutation | Average:64.814; most accessible tissue: Zhenshan97 root, score: 81.564 | N | N | N | N |
| vg0322639869 | C -> DEL | N | N | silent_mutation | Average:64.814; most accessible tissue: Zhenshan97 root, score: 81.564 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322639869 | NA | 4.85E-16 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | NA | 1.32E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | NA | 1.55E-10 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | 1.50E-06 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | 5.94E-06 | NA | mr1251_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | 1.29E-06 | NA | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | 6.13E-06 | NA | mr1435_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | 1.56E-06 | 6.25E-07 | mr1603_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | NA | 2.87E-28 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | NA | 3.02E-07 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | NA | 4.54E-10 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | NA | 6.31E-11 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322639869 | NA | 1.67E-17 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |