\
| Variant ID: vg0322632917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22632917 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGGACTTACCCCTTAGCCGGAGATCGAACACCGATGCAGCCCCGCGTCAGGTGCCAAGTCCCGCCGGATGATGAAATAAAGTAGAAAAGGTAAAAGGTGG[T/C]
GATGCGCCGAATTATATTGATCGTGAAGATAGATTACATAGACCTCGGGCGTACATATTTATACCCATGGGTTGATACAAGTCCTTGTCGGACAAGAAAG
CTTTCTTGTCCGACAAGGACTTGTATCAACCCATGGGTATAAATATGTACGCCCGAGGTCTATGTAATCTATCTTCACGATCAATATAATTCGGCGCATC[A/G]
CCACCTTTTACCTTTTCTACTTTATTTCATCATCCGGCGGGACTTGGCACCTGACGCGGGGCTGCATCGGTGTTCGATCTCCGGCTAAGGGGTAAGTCCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 35.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 54.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322632917 | T -> C | LOC_Os03g40710.1 | upstream_gene_variant ; 2225.0bp to feature; MODIFIER | silent_mutation | Average:35.887; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0322632917 | T -> C | LOC_Os03g40690.1 | downstream_gene_variant ; 4433.0bp to feature; MODIFIER | silent_mutation | Average:35.887; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0322632917 | T -> C | LOC_Os03g40700.1 | downstream_gene_variant ; 2574.0bp to feature; MODIFIER | silent_mutation | Average:35.887; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| vg0322632917 | T -> C | LOC_Os03g40700-LOC_Os03g40710 | intergenic_region ; MODIFIER | silent_mutation | Average:35.887; most accessible tissue: Zhenshan97 flag leaf, score: 58.104 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322632917 | NA | 2.45E-105 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 2.14E-104 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 4.07E-74 | mr1014 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 1.86E-67 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 1.76E-26 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 1.98E-81 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 3.74E-76 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 8.13E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 2.58E-85 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 3.15E-86 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 7.69E-37 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 5.00E-84 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 7.85E-60 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | 8.31E-10 | 2.19E-92 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | 5.36E-10 | 4.34E-155 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 2.71E-88 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 3.08E-17 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 1.32E-69 | mr1896 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 4.28E-78 | mr1907 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 8.66E-59 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | 5.26E-06 | 2.65E-122 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 3.87E-86 | mr1015_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 1.27E-16 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 1.18E-32 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 2.53E-18 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 4.99E-48 | mr1670_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 3.74E-37 | mr1689_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | 6.11E-10 | 7.40E-134 | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | 9.23E-11 | 7.21E-212 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 1.05E-66 | mr1889_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 1.23E-64 | mr1896_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 4.08E-93 | mr1907_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | NA | 1.22E-22 | mr1933_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322632917 | 2.23E-09 | 2.61E-175 | mr1987_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |