\
| Variant ID: vg0322631658 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22631658 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AATTTTTACTCTAATGTCATGTTTGAAGCATGTGGCCCTAAGGGCATTAAAGCGTATGAGGTCGATGGCCCGAGGTAGAGCACTCAATGGGTACATTCTC[G/A,T]
TCTTTCTTAAAAATTTATCTTTTCAACTGAGTCCAAAGTGTCCTATAGCAAATTACCAGTTTTTTAGGATGTATTTCAGCTATAACACGTTTTTTATGTC
GACATAAAAAACGTGTTATAGCTGAAATACATCCTAAAAAACTGGTAATTTGCTATAGGACACTTTGGACTCAGTTGAAAAGATAAATTTTTAAGAAAGA[C/T,A]
GAGAATGTACCCATTGAGTGCTCTACCTCGGGCCATCGACCTCATACGCTTTAATGCCCTTAGGGCCACATGCTTCAAACATGACATTAGAGTAAAAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 4.90% | 0.02% | 0.00% | T: 0.02% |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 24.20% | 75.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 3.10% | 1.04% | 0.00% | T: 1.04% |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322631658 | G -> T | LOC_Os03g40710.1 | upstream_gene_variant ; 3484.0bp to feature; MODIFIER | silent_mutation | Average:41.113; most accessible tissue: Callus, score: 57.473 | N | N | N | N |
| vg0322631658 | G -> T | LOC_Os03g40690.1 | downstream_gene_variant ; 3174.0bp to feature; MODIFIER | silent_mutation | Average:41.113; most accessible tissue: Callus, score: 57.473 | N | N | N | N |
| vg0322631658 | G -> T | LOC_Os03g40700.1 | downstream_gene_variant ; 1315.0bp to feature; MODIFIER | silent_mutation | Average:41.113; most accessible tissue: Callus, score: 57.473 | N | N | N | N |
| vg0322631658 | G -> T | LOC_Os03g40700-LOC_Os03g40710 | intergenic_region ; MODIFIER | silent_mutation | Average:41.113; most accessible tissue: Callus, score: 57.473 | N | N | N | N |
| vg0322631658 | G -> A | LOC_Os03g40710.1 | upstream_gene_variant ; 3484.0bp to feature; MODIFIER | silent_mutation | Average:41.113; most accessible tissue: Callus, score: 57.473 | N | N | N | N |
| vg0322631658 | G -> A | LOC_Os03g40690.1 | downstream_gene_variant ; 3174.0bp to feature; MODIFIER | silent_mutation | Average:41.113; most accessible tissue: Callus, score: 57.473 | N | N | N | N |
| vg0322631658 | G -> A | LOC_Os03g40700.1 | downstream_gene_variant ; 1315.0bp to feature; MODIFIER | silent_mutation | Average:41.113; most accessible tissue: Callus, score: 57.473 | N | N | N | N |
| vg0322631658 | G -> A | LOC_Os03g40700-LOC_Os03g40710 | intergenic_region ; MODIFIER | silent_mutation | Average:41.113; most accessible tissue: Callus, score: 57.473 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322631658 | NA | 1.05E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | 1.67E-06 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | 3.26E-07 | NA | mr1263_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | NA | 3.22E-09 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | NA | 2.93E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | NA | 3.77E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | NA | 1.30E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | NA | 2.93E-10 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | 7.30E-06 | NA | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | NA | 3.51E-11 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322631658 | NA | 1.41E-17 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |