\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322631658:

Variant ID: vg0322631658 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22631658
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTTTTACTCTAATGTCATGTTTGAAGCATGTGGCCCTAAGGGCATTAAAGCGTATGAGGTCGATGGCCCGAGGTAGAGCACTCAATGGGTACATTCTC[G/A,T]
TCTTTCTTAAAAATTTATCTTTTCAACTGAGTCCAAAGTGTCCTATAGCAAATTACCAGTTTTTTAGGATGTATTTCAGCTATAACACGTTTTTTATGTC

Reverse complement sequence

GACATAAAAAACGTGTTATAGCTGAAATACATCCTAAAAAACTGGTAATTTGCTATAGGACACTTTGGACTCAGTTGAAAAGATAAATTTTTAAGAAAGA[C/T,A]
GAGAATGTACCCATTGAGTGCTCTACCTCGGGCCATCGACCTCATACGCTTTAATGCCCTTAGGGCCACATGCTTCAAACATGACATTAGAGTAAAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 4.90% 0.02% 0.00% T: 0.02%
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 24.20% 75.80% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 1.04% 0.00% T: 1.04%
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322631658 G -> T LOC_Os03g40710.1 upstream_gene_variant ; 3484.0bp to feature; MODIFIER silent_mutation Average:41.113; most accessible tissue: Callus, score: 57.473 N N N N
vg0322631658 G -> T LOC_Os03g40690.1 downstream_gene_variant ; 3174.0bp to feature; MODIFIER silent_mutation Average:41.113; most accessible tissue: Callus, score: 57.473 N N N N
vg0322631658 G -> T LOC_Os03g40700.1 downstream_gene_variant ; 1315.0bp to feature; MODIFIER silent_mutation Average:41.113; most accessible tissue: Callus, score: 57.473 N N N N
vg0322631658 G -> T LOC_Os03g40700-LOC_Os03g40710 intergenic_region ; MODIFIER silent_mutation Average:41.113; most accessible tissue: Callus, score: 57.473 N N N N
vg0322631658 G -> A LOC_Os03g40710.1 upstream_gene_variant ; 3484.0bp to feature; MODIFIER silent_mutation Average:41.113; most accessible tissue: Callus, score: 57.473 N N N N
vg0322631658 G -> A LOC_Os03g40690.1 downstream_gene_variant ; 3174.0bp to feature; MODIFIER silent_mutation Average:41.113; most accessible tissue: Callus, score: 57.473 N N N N
vg0322631658 G -> A LOC_Os03g40700.1 downstream_gene_variant ; 1315.0bp to feature; MODIFIER silent_mutation Average:41.113; most accessible tissue: Callus, score: 57.473 N N N N
vg0322631658 G -> A LOC_Os03g40700-LOC_Os03g40710 intergenic_region ; MODIFIER silent_mutation Average:41.113; most accessible tissue: Callus, score: 57.473 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322631658 NA 1.05E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 1.67E-06 NA mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 3.26E-07 NA mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 NA 3.22E-09 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 NA 2.93E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 NA 3.77E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 NA 1.30E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 NA 2.93E-10 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 7.30E-06 NA mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 NA 3.51E-11 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322631658 NA 1.41E-17 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251