\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322619797:

Variant ID: vg0322619797 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22619797
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


ACAATGTTTCACTATTTATAGATCTAATGTTGCAGTGAATTAAAATACTCTTTTGCAACAAAAAAACCCATATATTTTGGAAACTCTCTATTAAGGGAAT[T/A]
TGGTTTATTTTTTGTTCCACCAAAAATGTTTCACCTAGTGTACTCATAATGTTTCACTATGTATAGATCTAATGTTGCAGCGAACGAAACATTCCATTGC

Reverse complement sequence

GCAATGGAATGTTTCGTTCGCTGCAACATTAGATCTATACATAGTGAAACATTATGAGTACACTAGGTGAAACATTTTTGGTGGAACAAAAAATAAACCA[A/T]
ATTCCCTTAATAGAGAGTTTCCAAAATATATGGGTTTTTTTGTTGCAAAAGAGTATTTTAATTCACTGCAACATTAGATCTATAAATAGTGAAACATTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 4.00% 10.94% 19.85% NA
All Indica  2759 50.00% 0.80% 16.60% 32.66% NA
All Japonica  1512 99.80% 0.00% 0.00% 0.20% NA
Aus  269 10.40% 60.60% 20.45% 8.55% NA
Indica I  595 15.80% 0.00% 43.87% 40.34% NA
Indica II  465 79.10% 0.00% 6.67% 14.19% NA
Indica III  913 55.90% 0.50% 4.49% 39.10% NA
Indica Intermediate  786 51.80% 2.00% 15.90% 30.28% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 82.20% 2.20% 4.44% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322619797 T -> A LOC_Os03g40690.1 upstream_gene_variant ; 4359.0bp to feature; MODIFIER silent_mutation Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0322619797 T -> A LOC_Os03g40670.1 downstream_gene_variant ; 244.0bp to feature; MODIFIER silent_mutation Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0322619797 T -> A LOC_Os03g40670-LOC_Os03g40690 intergenic_region ; MODIFIER silent_mutation Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg0322619797 T -> DEL N N silent_mutation Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322619797 NA 1.42E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797 NA 3.01E-16 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797 NA 6.06E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797 NA 6.02E-10 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797 NA 1.73E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797 NA 8.75E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797 NA 4.76E-06 mr1952 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797 5.43E-07 NA mr1248_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797 NA 7.54E-07 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251