\
| Variant ID: vg0322619797 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22619797 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 227. )
ACAATGTTTCACTATTTATAGATCTAATGTTGCAGTGAATTAAAATACTCTTTTGCAACAAAAAAACCCATATATTTTGGAAACTCTCTATTAAGGGAAT[T/A]
TGGTTTATTTTTTGTTCCACCAAAAATGTTTCACCTAGTGTACTCATAATGTTTCACTATGTATAGATCTAATGTTGCAGCGAACGAAACATTCCATTGC
GCAATGGAATGTTTCGTTCGCTGCAACATTAGATCTATACATAGTGAAACATTATGAGTACACTAGGTGAAACATTTTTGGTGGAACAAAAAATAAACCA[A/T]
ATTCCCTTAATAGAGAGTTTCCAAAATATATGGGTTTTTTTGTTGCAAAAGAGTATTTTAATTCACTGCAACATTAGATCTATAAATAGTGAAACATTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.20% | 4.00% | 10.94% | 19.85% | NA |
| All Indica | 2759 | 50.00% | 0.80% | 16.60% | 32.66% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Aus | 269 | 10.40% | 60.60% | 20.45% | 8.55% | NA |
| Indica I | 595 | 15.80% | 0.00% | 43.87% | 40.34% | NA |
| Indica II | 465 | 79.10% | 0.00% | 6.67% | 14.19% | NA |
| Indica III | 913 | 55.90% | 0.50% | 4.49% | 39.10% | NA |
| Indica Intermediate | 786 | 51.80% | 2.00% | 15.90% | 30.28% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 82.20% | 2.20% | 4.44% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322619797 | T -> A | LOC_Os03g40690.1 | upstream_gene_variant ; 4359.0bp to feature; MODIFIER | silent_mutation | Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg0322619797 | T -> A | LOC_Os03g40670.1 | downstream_gene_variant ; 244.0bp to feature; MODIFIER | silent_mutation | Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg0322619797 | T -> A | LOC_Os03g40670-LOC_Os03g40690 | intergenic_region ; MODIFIER | silent_mutation | Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| vg0322619797 | T -> DEL | N | N | silent_mutation | Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322619797 | NA | 1.42E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322619797 | NA | 3.01E-16 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322619797 | NA | 6.06E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322619797 | NA | 6.02E-10 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322619797 | NA | 1.73E-06 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322619797 | NA | 8.75E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322619797 | NA | 4.76E-06 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322619797 | 5.43E-07 | NA | mr1248_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322619797 | NA | 7.54E-07 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |