Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0322619797:

Variant ID: vg0322619797 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22619797
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, A: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

ACAATGTTTCACTATTTATAGATCTAATGTTGCAGTGAATTAAAATACTCTTTTGCAACAAAAAAACCCATATATTTTGGAAACTCTCTATTAAGGGAAT[T/A]
TGGTTTATTTTTTGTTCCACCAAAAATGTTTCACCTAGTGTACTCATAATGTTTCACTATGTATAGATCTAATGTTGCAGCGAACGAAACATTCCATTGC

Reverse complement sequence

GCAATGGAATGTTTCGTTCGCTGCAACATTAGATCTATACATAGTGAAACATTATGAGTACACTAGGTGAAACATTTTTGGTGGAACAAAAAATAAACCA[A/T]
ATTCCCTTAATAGAGAGTTTCCAAAATATATGGGTTTTTTTGTTGCAAAAGAGTATTTTAATTCACTGCAACATTAGATCTATAAATAGTGAAACATTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	4.00%	10.94%	19.85%	NA
All Indica	2759	50.00%	0.80%	16.60%	32.66%	NA
All Japonica	1512	99.80%	0.00%	0.00%	0.20%	NA
Aus	269	10.40%	60.60%	20.45%	8.55%	NA
Indica I	595	15.80%	0.00%	43.87%	40.34%	NA
Indica II	465	79.10%	0.00%	6.67%	14.19%	NA
Indica III	913	55.90%	0.50%	4.49%	39.10%	NA
Indica Intermediate	786	51.80%	2.00%	15.90%	30.28%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	82.20%	2.20%	4.44%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322619797	T -> A	LOC_Os03g40690.1	upstream_gene_variant ; 4359.0bp to feature; MODIFIER	silent_mutation	Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0322619797	T -> A	LOC_Os03g40670.1	downstream_gene_variant ; 244.0bp to feature; MODIFIER	silent_mutation	Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0322619797	T -> A	LOC_Os03g40670-LOC_Os03g40690	intergenic_region ; MODIFIER	silent_mutation	Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N
vg0322619797	T -> DEL	N	N	silent_mutation	Average:49.549; most accessible tissue: Minghui63 young leaf, score: 65.92	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322619797	NA	1.42E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797	NA	3.01E-16	mr1158	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797	NA	6.06E-09	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797	NA	6.02E-10	mr1499	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797	NA	1.73E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797	NA	8.75E-07	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797	NA	4.76E-06	mr1952	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797	5.43E-07	NA	mr1248_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322619797	NA	7.54E-07	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251