| Variant ID: vg0322604711 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22604711 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGGTTCGGGTGCTCTAAGGTGCTCTCTATAAAACATGTACATCTCAGCAATAGACTCGATTAATAGTAAACCACCTCAATAGTATGTCTACATTGGTAT[C/T]
TATAGCTCTCTCATGCATTGCCTCGTTTTTCTCTATAGACTATCTATAAGTTAGTAGATAGCTTTGCTCTCTCTCTTCATTTAATACCTTCCAAGTAGGA
TCCTACTTGGAAGGTATTAAATGAAGAGAGAGAGCAAAGCTATCTACTAACTTATAGATAGTCTATAGAGAAAAACGAGGCAATGCATGAGAGAGCTATA[G/A]
ATACCAATGTAGACATACTATTGAGGTGGTTTACTATTAATCGAGTCTATTGCTGAGATGTACATGTTTTATAGAGAGCACCTTAGAGCACCCGAACCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.00% | 0.40% | 7.05% | 46.49% | NA |
| All Indica | 2759 | 11.20% | 0.70% | 11.45% | 76.69% | NA |
| All Japonica | 1512 | 99.40% | 0.10% | 0.07% | 0.46% | NA |
| Aus | 269 | 79.60% | 0.00% | 3.72% | 16.73% | NA |
| Indica I | 595 | 6.70% | 0.00% | 17.14% | 76.13% | NA |
| Indica II | 465 | 6.70% | 1.10% | 5.16% | 87.10% | NA |
| Indica III | 913 | 13.50% | 1.30% | 11.83% | 73.38% | NA |
| Indica Intermediate | 786 | 14.50% | 0.30% | 10.43% | 74.81% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 98.80% | 0.20% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 64.40% | 0.00% | 5.56% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322604711 | C -> T | LOC_Os03g40650.1 | upstream_gene_variant ; 678.0bp to feature; MODIFIER | silent_mutation | Average:48.219; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0322604711 | C -> T | LOC_Os03g40650-LOC_Os03g40670 | intergenic_region ; MODIFIER | silent_mutation | Average:48.219; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| vg0322604711 | C -> DEL | N | N | silent_mutation | Average:48.219; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322604711 | NA | 8.39E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322604711 | NA | 7.80E-06 | mr1114_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322604711 | NA | 7.15E-08 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322604711 | NA | 5.48E-07 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322604711 | NA | 1.37E-07 | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322604711 | NA | 2.43E-07 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |