\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322574715:

Variant ID: vg0322574715 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22574715
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCGTATGAAACAATAAATTTGTATTGTTTGAAACATATGTTTTTCTTTTATCAGAATATAATCATTATTGACGGTCGTTATCGATCAGTTTCGACCGT[C/T]
AATATTACTAAAACAGGAGAGAACTAGTGATGCTTTCAATGCATATATTTGTTAGAATAATAATATTCCACTAGTGTTAGGTTTACTAACCTTTTGCAGA

Reverse complement sequence

TCTGCAAAAGGTTAGTAAACCTAACACTAGTGGAATATTATTATTCTAACAAATATATGCATTGAAAGCATCACTAGTTCTCTCCTGTTTTAGTAATATT[G/A]
ACGGTCGAAACTGATCGATAACGACCGTCAATAATGATTATATTCTGATAAAAGAAAAACATATGTTTCAAACAATACAAATTTATTGTTTCATACGCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 4.90% 0.00% 0.00% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 23.80% 76.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 2.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322574715 C -> T LOC_Os03g40610.1 upstream_gene_variant ; 707.0bp to feature; MODIFIER silent_mutation Average:34.185; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0322574715 C -> T LOC_Os03g40610-LOC_Os03g40630 intergenic_region ; MODIFIER silent_mutation Average:34.185; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322574715 NA 2.05E-17 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322574715 NA 1.69E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322574715 3.07E-06 NA mr1148_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322574715 7.08E-06 NA mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322574715 NA 1.63E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322574715 NA 4.54E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322574715 NA 3.20E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322574715 NA 1.51E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251