\
| Variant ID: vg0322574715 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22574715 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 259. )
TCGCGTATGAAACAATAAATTTGTATTGTTTGAAACATATGTTTTTCTTTTATCAGAATATAATCATTATTGACGGTCGTTATCGATCAGTTTCGACCGT[C/T]
AATATTACTAAAACAGGAGAGAACTAGTGATGCTTTCAATGCATATATTTGTTAGAATAATAATATTCCACTAGTGTTAGGTTTACTAACCTTTTGCAGA
TCTGCAAAAGGTTAGTAAACCTAACACTAGTGGAATATTATTATTCTAACAAATATATGCATTGAAAGCATCACTAGTTCTCTCCTGTTTTAGTAATATT[G/A]
ACGGTCGAAACTGATCGATAACGACCGTCAATAATGATTATATTCTGATAAAAGAAAAACATATGTTTCAAACAATACAAATTTATTGTTTCATACGCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 23.80% | 76.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322574715 | C -> T | LOC_Os03g40610.1 | upstream_gene_variant ; 707.0bp to feature; MODIFIER | silent_mutation | Average:34.185; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| vg0322574715 | C -> T | LOC_Os03g40610-LOC_Os03g40630 | intergenic_region ; MODIFIER | silent_mutation | Average:34.185; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322574715 | NA | 2.05E-17 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322574715 | NA | 1.69E-08 | mr1442 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322574715 | 3.07E-06 | NA | mr1148_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322574715 | 7.08E-06 | NA | mr1152_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322574715 | NA | 1.63E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322574715 | NA | 4.54E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322574715 | NA | 3.20E-06 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322574715 | NA | 1.51E-07 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |