\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322565972:

Variant ID: vg0322565972 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22565972
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGACTATGGAACAAGGACGGCGAGAGGCGGAGGATCGTGCGGGTACTCTGCCAAGCCAGAGGCCTCTTGGGCGAAGGATGCAGGGCGAAGAGTATATGC[T/C]
GAAGGGAGACGACTTCACCAAAGCAAGCTCGCCCCCGCGAGGGCCGAAGAAGCCTTTTTCGGCCTATCAAGCATAGGGGCCATTAGGCCGACGATCGCCT

Reverse complement sequence

AGGCGATCGTCGGCCTAATGGCCCCTATGCTTGATAGGCCGAAAAAGGCTTCTTCGGCCCTCGCGGGGGCGAGCTTGCTTTGGTGAAGTCGTCTCCCTTC[A/G]
GCATATACTCTTCGCCCTGCATCCTTCGCCCAAGAGGCCTCTGGCTTGGCAGAGTACCCGCACGATCCTCCGCCTCTCGCCGTCCTTGTTCCATAGTCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 36.00% 0.13% 0.00% NA
All Indica  2759 97.90% 1.90% 0.14% 0.00% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 98.70% 1.20% 0.17% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.20% 0.38% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 43.30% 54.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322565972 T -> C LOC_Os03g40580.1 upstream_gene_variant ; 1257.0bp to feature; MODIFIER silent_mutation Average:67.49; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0322565972 T -> C LOC_Os03g40600.1 downstream_gene_variant ; 1698.0bp to feature; MODIFIER silent_mutation Average:67.49; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0322565972 T -> C LOC_Os03g40580-LOC_Os03g40600 intergenic_region ; MODIFIER silent_mutation Average:67.49; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322565972 NA 2.17E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 7.44E-35 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 6.21E-82 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 4.61E-11 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 1.74E-09 4.83E-149 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 2.05E-07 9.49E-19 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 6.33E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 1.87E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 9.98E-108 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 2.99E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 1.50E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 1.33E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 8.04E-20 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 6.49E-06 5.94E-120 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 NA 2.31E-14 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 2.88E-12 3.87E-201 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 1.15E-12 2.31E-33 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 3.85E-07 1.48E-151 mr1987_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322565972 5.78E-11 1.91E-14 mr1987_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251