\
| Variant ID: vg0322565972 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22565972 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGACTATGGAACAAGGACGGCGAGAGGCGGAGGATCGTGCGGGTACTCTGCCAAGCCAGAGGCCTCTTGGGCGAAGGATGCAGGGCGAAGAGTATATGC[T/C]
GAAGGGAGACGACTTCACCAAAGCAAGCTCGCCCCCGCGAGGGCCGAAGAAGCCTTTTTCGGCCTATCAAGCATAGGGGCCATTAGGCCGACGATCGCCT
AGGCGATCGTCGGCCTAATGGCCCCTATGCTTGATAGGCCGAAAAAGGCTTCTTCGGCCCTCGCGGGGGCGAGCTTGCTTTGGTGAAGTCGTCTCCCTTC[A/G]
GCATATACTCTTCGCCCTGCATCCTTCGCCCAAGAGGCCTCTGGCTTGGCAGAGTACCCGCACGATCCTCCGCCTCTCGCCGTCCTTGTTCCATAGTCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 36.00% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 1.90% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.20% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 54.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322565972 | T -> C | LOC_Os03g40580.1 | upstream_gene_variant ; 1257.0bp to feature; MODIFIER | silent_mutation | Average:67.49; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0322565972 | T -> C | LOC_Os03g40600.1 | downstream_gene_variant ; 1698.0bp to feature; MODIFIER | silent_mutation | Average:67.49; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0322565972 | T -> C | LOC_Os03g40580-LOC_Os03g40600 | intergenic_region ; MODIFIER | silent_mutation | Average:67.49; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322565972 | NA | 2.17E-16 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 7.44E-35 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 6.21E-82 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 4.61E-11 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | 1.74E-09 | 4.83E-149 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | 2.05E-07 | 9.49E-19 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 6.33E-16 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 1.87E-13 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 9.98E-108 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 2.99E-11 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 1.50E-22 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 1.33E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 8.04E-20 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | 6.49E-06 | 5.94E-120 | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | NA | 2.31E-14 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | 2.88E-12 | 3.87E-201 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | 1.15E-12 | 2.31E-33 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | 3.85E-07 | 1.48E-151 | mr1987_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322565972 | 5.78E-11 | 1.91E-14 | mr1987_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |