\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322556933:

Variant ID: vg0322556933 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22556933
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGTCGAAGAAGTGCAAGCCCTCCGCAAGGAGTTCGACGCTTAGCAAGCAAGCAACCATCAGCAGCCTGTCCGAAAGAAGGTCCGAAAAGACCTCTACTG[T/C]
GCCTTCCACGGACGCTCTTCGCACACCACGGAGCAATGCCGAAATATTTGGCAACGTGGCAACGCGCAAGATCCAAGGACGCAGCAGGGAGCAGCGGCCG

Reverse complement sequence

CGGCCGCTGCTCCCTGCTGCGTCCTTGGATCTTGCGCGTTGCCACGTTGCCAAATATTTCGGCATTGCTCCGTGGTGTGCGAAGAGCGTCCGTGGAAGGC[A/G]
CAGTAGAGGTCTTTTCGGACCTTCTTTCGGACAGGCTGCTGATGGTTGCTTGCTTGCTAAGCGTCGAACTCCTTGCGGAGGGCTTGCACTTCTTCGACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 36.70% 0.17% 6.94% NA
All Indica  2759 84.80% 3.10% 0.25% 11.82% NA
All Japonica  1512 0.70% 99.30% 0.00% 0.00% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 53.60% 4.50% 0.84% 41.01% NA
Indica II  465 93.10% 3.70% 0.00% 3.23% NA
Indica III  913 99.00% 0.90% 0.00% 0.11% NA
Indica Intermediate  786 87.00% 4.30% 0.25% 8.40% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 40.00% 57.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322556933 T -> C LOC_Os03g40570.1 upstream_gene_variant ; 3013.0bp to feature; MODIFIER silent_mutation Average:29.256; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0322556933 T -> C LOC_Os03g40550.1 downstream_gene_variant ; 4887.0bp to feature; MODIFIER silent_mutation Average:29.256; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0322556933 T -> C LOC_Os03g40560.1 intron_variant ; MODIFIER silent_mutation Average:29.256; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N
vg0322556933 T -> DEL N N silent_mutation Average:29.256; most accessible tissue: Minghui63 young leaf, score: 65.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322556933 2.09E-06 NA mr1231 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933 NA 1.51E-07 mr1408 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933 NA 1.34E-06 mr1408 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933 NA 4.86E-09 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933 NA 2.55E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933 NA 5.47E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322556933 NA 1.72E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251