Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322533828:

Variant ID: vg0322533828 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22533828
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGTATAGCCTACTATTAGCTCCAATTTATTTATAGCCAATTCATTTAATAGTTGCTTACTATACTATTAATATATGGTCCTACATGTCAAACAGACATCG[C/T]
TTCTTGGAGTCAACACTGTAGCTAGTTGCAGATCTATAGCCCGTTGTTCTTCTCTCTCATCTTTTATCTCATTAAAATATGTTTACAGCTGGCTAATAGC

Reverse complement sequence

GCTATTAGCCAGCTGTAAACATATTTTAATGAGATAAAAGATGAGAGAGAAGAACAACGGGCTATAGATCTGCAACTAGCTACAGTGTTGACTCCAAGAA[G/A]
CGATGTCTGTTTGACATGTAGGACCATATATTAATAGTATAGTAAGCAACTATTAAATGAATTGGCTATAAATAAATTGGAGCTAATAGTAGGCTATACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 10.00% 0.80% 0.00% NA
All Indica  2759 99.20% 0.60% 0.22% 0.00% NA
All Japonica  1512 68.90% 29.00% 2.05% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.10% 0.51% 0.00% NA
Temperate Japonica  767 98.00% 0.50% 1.43% 0.00% NA
Tropical Japonica  504 18.30% 78.60% 3.17% 0.00% NA
Japonica Intermediate  241 82.20% 16.20% 1.66% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322533828 C -> T LOC_Os03g40540.1 upstream_gene_variant ; 4513.0bp to feature; MODIFIER silent_mutation Average:90.329; most accessible tissue: Minghui63 panicle, score: 98.31 N N N N
vg0322533828 C -> T LOC_Os03g40520.1 downstream_gene_variant ; 1293.0bp to feature; MODIFIER silent_mutation Average:90.329; most accessible tissue: Minghui63 panicle, score: 98.31 N N N N
vg0322533828 C -> T LOC_Os03g40520-LOC_Os03g40540 intergenic_region ; MODIFIER silent_mutation Average:90.329; most accessible tissue: Minghui63 panicle, score: 98.31 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0322533828 C T -0.01 -0.02 -0.02 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322533828 NA 5.47E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322533828 NA 7.46E-18 Grain_width Jap_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322533828 NA 4.64E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 1.36E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 3.66E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 8.06E-13 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 1.11E-08 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 5.61E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 8.86E-19 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 4.72E-08 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 3.92E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 5.65E-06 1.16E-15 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 1.72E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 1.02E-07 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 4.28E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 2.65E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 3.86E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 8.51E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322533828 NA 6.67E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251