\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322532678:

Variant ID: vg0322532678 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22532678
Reference Allele: AAlternative Allele: T,G
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGATTTGTACTTGTTGCTAGATTTTTCCTACCAAACTTTGTGCAAATGTGGTACGTCAAAGTTTAGAAACGCAACATCCATCAATGATTGGAGGAAAA[A/T,G]
ATTGGCAAGAAGATGAACCTAATAGGCCCTAGCCAATGGCAAATTAAGAGAATCTTGTCACATATAGTAGCCATCCAATACTTGCTAAATCTTCTAGTGA

Reverse complement sequence

TCACTAGAAGATTTAGCAAGTATTGGATGGCTACTATATGTGACAAGATTCTCTTAATTTGCCATTGGCTAGGGCCTATTAGGTTCATCTTCTTGCCAAT[T/A,C]
TTTTCCTCCAATCATTGATGGATGTTGCGTTTCTAAACTTTGACGTACCACATTTGCACAAAGTTTGGTAGGAAAAATCTAGCAACAAGTACAAATCAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 29.50% 0.04% 0.00% G: 0.02%
All Indica  2759 52.10% 47.80% 0.07% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 79.60% 20.10% 0.00% 0.00% G: 0.37%
Indica I  595 49.40% 50.40% 0.17% 0.00% NA
Indica II  465 78.70% 21.30% 0.00% 0.00% NA
Indica III  913 39.30% 60.60% 0.11% 0.00% NA
Indica Intermediate  786 53.30% 46.70% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322532678 A -> T LOC_Os03g40520.1 downstream_gene_variant ; 143.0bp to feature; MODIFIER silent_mutation Average:72.801; most accessible tissue: Zhenshan97 flower, score: 91.289 N N N N
vg0322532678 A -> T LOC_Os03g40520-LOC_Os03g40540 intergenic_region ; MODIFIER silent_mutation Average:72.801; most accessible tissue: Zhenshan97 flower, score: 91.289 N N N N
vg0322532678 A -> G LOC_Os03g40520.1 downstream_gene_variant ; 143.0bp to feature; MODIFIER silent_mutation Average:72.801; most accessible tissue: Zhenshan97 flower, score: 91.289 N N N N
vg0322532678 A -> G LOC_Os03g40520-LOC_Os03g40540 intergenic_region ; MODIFIER silent_mutation Average:72.801; most accessible tissue: Zhenshan97 flower, score: 91.289 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0322532678 A G 0.03 0.01 0.01 0.02 0.03 0.03
vg0322532678 A T 0.0 0.0 -0.01 -0.02 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322532678 NA 1.01E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 7.56E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 1.10E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 6.11E-07 mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 4.54E-07 mr1204_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 6.98E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 2.41E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 6.53E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 5.23E-07 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 7.47E-09 mr1566_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 2.86E-07 mr1566_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 4.97E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 8.04E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 3.27E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 1.56E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 7.59E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 1.13E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 2.82E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 1.07E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 6.65E-06 6.86E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 9.55E-07 mr1876_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 4.68E-06 mr1901_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 NA 2.25E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 6.68E-06 1.93E-10 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322532678 9.08E-06 9.08E-06 mr1947_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251