\
| Variant ID: vg0322461073 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22461073 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.11, others allele: 0.00, population size: 186. )
TGCATTTATTTTCGAATGTCACCGGGTCGTGTGAACCTATTCCTTTGTTTATGGCCAATTTGCATTGATTACCCTATTCCTTGATACCTTGGGTAATAAA[T/C]
TGATTAGCTTGAACCTTATATATTGGTTTGGTTCAGCTAAATGCCATATATATATAATTGCTTAGCCATGCTTAGAAACATTAGTTCATTAATGGGATGA
TCATCCCATTAATGAACTAATGTTTCTAAGCATGGCTAAGCAATTATATATATATGGCATTTAGCTGAACCAAACCAATATATAAGGTTCAAGCTAATCA[A/G]
TTTATTACCCAAGGTATCAAGGAATAGGGTAATCAATGCAAATTGGCCATAAACAAAGGAATAGGTTCACACGACCCGGTGACATTCGAAAATAAATGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 33.70% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 1.90% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 7.50% | 92.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 0.90% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 2.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 97.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 50.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322461073 | T -> C | LOC_Os03g40440.1 | upstream_gene_variant ; 3445.0bp to feature; MODIFIER | silent_mutation | Average:34.362; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0322461073 | T -> C | LOC_Os03g40430.1 | downstream_gene_variant ; 1234.0bp to feature; MODIFIER | silent_mutation | Average:34.362; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| vg0322461073 | T -> C | LOC_Os03g40410-LOC_Os03g40430 | intergenic_region ; MODIFIER | silent_mutation | Average:34.362; most accessible tissue: Zhenshan97 panicle, score: 46.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322461073 | NA | 1.07E-14 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | NA | 5.43E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | NA | 2.93E-11 | mr1713 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | 1.33E-06 | 2.82E-82 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | 4.18E-07 | 4.71E-11 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | 6.67E-06 | 1.06E-123 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | NA | 4.00E-13 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | NA | 5.80E-13 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | NA | 6.91E-111 | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | NA | 8.70E-12 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | 2.48E-07 | 5.40E-154 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322461073 | 4.67E-12 | 4.22E-23 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |