\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322461073:

Variant ID: vg0322461073 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22461073
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.11, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


TGCATTTATTTTCGAATGTCACCGGGTCGTGTGAACCTATTCCTTTGTTTATGGCCAATTTGCATTGATTACCCTATTCCTTGATACCTTGGGTAATAAA[T/C]
TGATTAGCTTGAACCTTATATATTGGTTTGGTTCAGCTAAATGCCATATATATATAATTGCTTAGCCATGCTTAGAAACATTAGTTCATTAATGGGATGA

Reverse complement sequence

TCATCCCATTAATGAACTAATGTTTCTAAGCATGGCTAAGCAATTATATATATATGGCATTTAGCTGAACCAAACCAATATATAAGGTTCAAGCTAATCA[A/G]
TTTATTACCCAAGGTATCAAGGAATAGGGTAATCAATGCAAATTGGCCATAAACAAAGGAATAGGTTCACACGACCCGGTGACATTCGAAAATAAATGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.10% 33.70% 0.19% 0.00% NA
All Indica  2759 97.90% 1.90% 0.25% 0.00% NA
All Japonica  1512 7.50% 92.50% 0.07% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 98.20% 1.50% 0.34% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.80% 0.90% 0.33% 0.00% NA
Indica Intermediate  786 96.80% 2.90% 0.25% 0.00% NA
Temperate Japonica  767 2.00% 97.90% 0.13% 0.00% NA
Tropical Japonica  504 5.60% 94.40% 0.00% 0.00% NA
Japonica Intermediate  241 29.00% 71.00% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322461073 T -> C LOC_Os03g40440.1 upstream_gene_variant ; 3445.0bp to feature; MODIFIER silent_mutation Average:34.362; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0322461073 T -> C LOC_Os03g40430.1 downstream_gene_variant ; 1234.0bp to feature; MODIFIER silent_mutation Average:34.362; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0322461073 T -> C LOC_Os03g40410-LOC_Os03g40430 intergenic_region ; MODIFIER silent_mutation Average:34.362; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322461073 NA 1.07E-14 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 NA 5.43E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 NA 2.93E-11 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 1.33E-06 2.82E-82 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 4.18E-07 4.71E-11 mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 6.67E-06 1.06E-123 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 NA 4.00E-13 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 NA 5.80E-13 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 NA 6.91E-111 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 NA 8.70E-12 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 2.48E-07 5.40E-154 mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073 4.67E-12 4.22E-23 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251