Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322461073:

Variant ID: vg0322461073 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22461073
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.11, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:

TGCATTTATTTTCGAATGTCACCGGGTCGTGTGAACCTATTCCTTTGTTTATGGCCAATTTGCATTGATTACCCTATTCCTTGATACCTTGGGTAATAAA[T/C]
TGATTAGCTTGAACCTTATATATTGGTTTGGTTCAGCTAAATGCCATATATATATAATTGCTTAGCCATGCTTAGAAACATTAGTTCATTAATGGGATGA

Reverse complement sequence

TCATCCCATTAATGAACTAATGTTTCTAAGCATGGCTAAGCAATTATATATATATGGCATTTAGCTGAACCAAACCAATATATAAGGTTCAAGCTAATCA[A/G]
TTTATTACCCAAGGTATCAAGGAATAGGGTAATCAATGCAAATTGGCCATAAACAAAGGAATAGGTTCACACGACCCGGTGACATTCGAAAATAAATGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.10%	33.70%	0.19%	0.00%	NA
All Indica	2759	97.90%	1.90%	0.25%	0.00%	NA
All Japonica	1512	7.50%	92.50%	0.07%	0.00%	NA
Aus	269	95.50%	4.50%	0.00%	0.00%	NA
Indica I	595	98.20%	1.50%	0.34%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.80%	0.90%	0.33%	0.00%	NA
Indica Intermediate	786	96.80%	2.90%	0.25%	0.00%	NA
Temperate Japonica	767	2.00%	97.90%	0.13%	0.00%	NA
Tropical Japonica	504	5.60%	94.40%	0.00%	0.00%	NA
Japonica Intermediate	241	29.00%	71.00%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	48.90%	50.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322461073	T -> C	LOC_Os03g40440.1	upstream_gene_variant ; 3445.0bp to feature; MODIFIER	silent_mutation	Average:34.362; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0322461073	T -> C	LOC_Os03g40430.1	downstream_gene_variant ; 1234.0bp to feature; MODIFIER	silent_mutation	Average:34.362; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0322461073	T -> C	LOC_Os03g40410-LOC_Os03g40430	intergenic_region ; MODIFIER	silent_mutation	Average:34.362; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322461073	NA	1.07E-14	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	NA	5.43E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	NA	2.93E-11	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	1.33E-06	2.82E-82	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	4.18E-07	4.71E-11	mr1718	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	6.67E-06	1.06E-123	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	NA	4.00E-13	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	NA	5.80E-13	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	NA	6.91E-111	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	NA	8.70E-12	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	2.48E-07	5.40E-154	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322461073	4.67E-12	4.22E-23	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251