Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322429997:

Variant ID: vg0322429997 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22429997
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTGCTTGCTTGAGCTAGAGTTGAGTCTAGACTAGGCCAGCACATTGACTAGTAATTTGAACTATTATTCAACTTTGCATTTTCTGATTAGTACAATTG[T/C]
GTTCCTTTGCTACTATATATTGTGCCTCCCAAGTTCCACATATATTCTTCTGGTCAGCACTGCTTTGATCCTTGCAATCGCCACATCACGTCCTTCAAGG

Reverse complement sequence

CCTTGAAGGACGTGATGTGGCGATTGCAAGGATCAAAGCAGTGCTGACCAGAAGAATATATGTGGAACTTGGGAGGCACAATATATAGTAGCAAAGGAAC[A/G]
CAATTGTACTAATCAGAAAATGCAAAGTTGAATAATAGTTCAAATTACTAGTCAATGTGCTGGCCTAGTCTAGACTCAACTCTAGCTCAAGCAAGCACCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	31.80%	0.76%	3.07%	NA
All Indica	2759	97.90%	1.70%	0.07%	0.33%	NA
All Japonica	1512	2.20%	91.30%	2.12%	4.37%	NA
Aus	269	95.20%	4.50%	0.00%	0.37%	NA
Indica I	595	98.50%	1.30%	0.17%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.70%	0.70%	0.00%	0.66%	NA
Indica Intermediate	786	96.90%	2.50%	0.13%	0.38%	NA
Temperate Japonica	767	0.40%	98.70%	0.26%	0.65%	NA
Tropical Japonica	504	5.20%	90.50%	0.60%	3.77%	NA
Japonica Intermediate	241	1.70%	69.70%	11.20%	17.43%	NA
VI/Aromatic	96	9.40%	26.00%	0.00%	64.58%	NA
Intermediate	90	47.80%	42.20%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322429997	T -> C	LOC_Os03g40360.1	upstream_gene_variant ; 241.0bp to feature; MODIFIER	silent_mutation	Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0322429997	T -> C	LOC_Os03g40370.1	downstream_gene_variant ; 4878.0bp to feature; MODIFIER	silent_mutation	Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0322429997	T -> C	LOC_Os03g40330-LOC_Os03g40360	intergenic_region ; MODIFIER	silent_mutation	Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0322429997	T -> DEL	N	N	silent_mutation	Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322429997	7.07E-07	7.06E-07	mr1261	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997	NA	2.73E-78	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997	NA	5.78E-118	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997	NA	5.55E-35	mr1828	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997	NA	9.18E-42	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997	NA	2.31E-24	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997	NA	8.97E-66	mr1828_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251