\
| Variant ID: vg0322429997 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22429997 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 236. )
GGGTGCTTGCTTGAGCTAGAGTTGAGTCTAGACTAGGCCAGCACATTGACTAGTAATTTGAACTATTATTCAACTTTGCATTTTCTGATTAGTACAATTG[T/C]
GTTCCTTTGCTACTATATATTGTGCCTCCCAAGTTCCACATATATTCTTCTGGTCAGCACTGCTTTGATCCTTGCAATCGCCACATCACGTCCTTCAAGG
CCTTGAAGGACGTGATGTGGCGATTGCAAGGATCAAAGCAGTGCTGACCAGAAGAATATATGTGGAACTTGGGAGGCACAATATATAGTAGCAAAGGAAC[A/G]
CAATTGTACTAATCAGAAAATGCAAAGTTGAATAATAGTTCAAATTACTAGTCAATGTGCTGGCCTAGTCTAGACTCAACTCTAGCTCAAGCAAGCACCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.40% | 31.80% | 0.76% | 3.07% | NA |
| All Indica | 2759 | 97.90% | 1.70% | 0.07% | 0.33% | NA |
| All Japonica | 1512 | 2.20% | 91.30% | 2.12% | 4.37% | NA |
| Aus | 269 | 95.20% | 4.50% | 0.00% | 0.37% | NA |
| Indica I | 595 | 98.50% | 1.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 0.70% | 0.00% | 0.66% | NA |
| Indica Intermediate | 786 | 96.90% | 2.50% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 0.40% | 98.70% | 0.26% | 0.65% | NA |
| Tropical Japonica | 504 | 5.20% | 90.50% | 0.60% | 3.77% | NA |
| Japonica Intermediate | 241 | 1.70% | 69.70% | 11.20% | 17.43% | NA |
| VI/Aromatic | 96 | 9.40% | 26.00% | 0.00% | 64.58% | NA |
| Intermediate | 90 | 47.80% | 42.20% | 2.22% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322429997 | T -> C | LOC_Os03g40360.1 | upstream_gene_variant ; 241.0bp to feature; MODIFIER | silent_mutation | Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0322429997 | T -> C | LOC_Os03g40370.1 | downstream_gene_variant ; 4878.0bp to feature; MODIFIER | silent_mutation | Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0322429997 | T -> C | LOC_Os03g40330-LOC_Os03g40360 | intergenic_region ; MODIFIER | silent_mutation | Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| vg0322429997 | T -> DEL | N | N | silent_mutation | Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322429997 | 7.07E-07 | 7.06E-07 | mr1261 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429997 | NA | 2.73E-78 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429997 | NA | 5.78E-118 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429997 | NA | 5.55E-35 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429997 | NA | 9.18E-42 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429997 | NA | 2.31E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429997 | NA | 8.97E-66 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |