\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322429997:

Variant ID: vg0322429997 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22429997
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTGCTTGCTTGAGCTAGAGTTGAGTCTAGACTAGGCCAGCACATTGACTAGTAATTTGAACTATTATTCAACTTTGCATTTTCTGATTAGTACAATTG[T/C]
GTTCCTTTGCTACTATATATTGTGCCTCCCAAGTTCCACATATATTCTTCTGGTCAGCACTGCTTTGATCCTTGCAATCGCCACATCACGTCCTTCAAGG

Reverse complement sequence

CCTTGAAGGACGTGATGTGGCGATTGCAAGGATCAAAGCAGTGCTGACCAGAAGAATATATGTGGAACTTGGGAGGCACAATATATAGTAGCAAAGGAAC[A/G]
CAATTGTACTAATCAGAAAATGCAAAGTTGAATAATAGTTCAAATTACTAGTCAATGTGCTGGCCTAGTCTAGACTCAACTCTAGCTCAAGCAAGCACCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 31.80% 0.76% 3.07% NA
All Indica  2759 97.90% 1.70% 0.07% 0.33% NA
All Japonica  1512 2.20% 91.30% 2.12% 4.37% NA
Aus  269 95.20% 4.50% 0.00% 0.37% NA
Indica I  595 98.50% 1.30% 0.17% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.70% 0.70% 0.00% 0.66% NA
Indica Intermediate  786 96.90% 2.50% 0.13% 0.38% NA
Temperate Japonica  767 0.40% 98.70% 0.26% 0.65% NA
Tropical Japonica  504 5.20% 90.50% 0.60% 3.77% NA
Japonica Intermediate  241 1.70% 69.70% 11.20% 17.43% NA
VI/Aromatic  96 9.40% 26.00% 0.00% 64.58% NA
Intermediate  90 47.80% 42.20% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322429997 T -> C LOC_Os03g40360.1 upstream_gene_variant ; 241.0bp to feature; MODIFIER silent_mutation Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0322429997 T -> C LOC_Os03g40370.1 downstream_gene_variant ; 4878.0bp to feature; MODIFIER silent_mutation Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0322429997 T -> C LOC_Os03g40330-LOC_Os03g40360 intergenic_region ; MODIFIER silent_mutation Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N
vg0322429997 T -> DEL N N silent_mutation Average:37.433; most accessible tissue: Minghui63 young leaf, score: 59.171 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322429997 7.07E-07 7.06E-07 mr1261 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997 NA 2.73E-78 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997 NA 5.78E-118 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997 NA 5.55E-35 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997 NA 9.18E-42 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997 NA 2.31E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322429997 NA 8.97E-66 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251