| Variant ID: vg0322429158 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr03 | Position: 22429158 |
| Reference Allele: A | Alternative Allele: C,T,ACC |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, A: 0.06, others allele: 0.00, population size: 213. )
AGTATTGCATCTGTTCATCACCTAGATCTAGGGTTCATCACTCAAGTGTGAGAGTTGTACGTCAGTTTTGGGTTCAGTTTTTCATCTCGTCGATTGTTGC[A/C,T,ACC]
GGGACCTTGAAAAATTGAATCGTCTCGTCGTCGGGTTTCCGTTTTTGTGATTTGGAGAAATTTTTATCGAGTGGTTAGAGAGTTGCTTGATTTCTAGGGT
ACCCTAGAAATCAAGCAACTCTCTAACCACTCGATAAAAATTTCTCCAAATCACAAAAACGGAAACCCGACGACGAGACGATTCAATTTTTCAAGGTCCC[T/G,A,GGT]
GCAACAATCGACGAGATGAAAAACTGAACCCAAAACTGACGTACAACTCTCACACTTGAGTGATGAACCCTAGATCTAGGTGATGAACAGATGCAATACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 28.50% | 2.29% | 3.17% | T: 0.02% |
| All Indica | 2759 | 98.10% | 1.50% | 0.04% | 0.29% | T: 0.04% |
| All Japonica | 1512 | 2.40% | 82.30% | 6.68% | 8.60% | NA |
| Aus | 269 | 95.50% | 1.90% | 0.74% | 1.86% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.50% | 0.00% | 0.11% | T: 0.11% |
| Indica Intermediate | 786 | 96.90% | 2.20% | 0.00% | 0.89% | NA |
| Temperate Japonica | 767 | 0.40% | 83.80% | 10.95% | 4.82% | NA |
| Tropical Japonica | 504 | 5.20% | 87.90% | 2.38% | 4.56% | NA |
| Japonica Intermediate | 241 | 2.90% | 66.00% | 2.07% | 29.05% | NA |
| VI/Aromatic | 96 | 76.00% | 13.50% | 3.12% | 7.29% | NA |
| Intermediate | 90 | 54.40% | 44.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322429158 | A -> C | LOC_Os03g40330.1 | upstream_gene_variant ; 4317.0bp to feature; MODIFIER | silent_mutation | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0322429158 | A -> C | LOC_Os03g40360.1 | upstream_gene_variant ; 1080.0bp to feature; MODIFIER | silent_mutation | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0322429158 | A -> C | LOC_Os03g40330-LOC_Os03g40360 | intergenic_region ; MODIFIER | silent_mutation | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0322429158 | A -> DEL | N | N | silent_mutation | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0322429158 | A -> ACC | LOC_Os03g40330.1 | upstream_gene_variant ; 4318.0bp to feature; MODIFIER | N | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0322429158 | A -> ACC | LOC_Os03g40360.1 | upstream_gene_variant ; 1079.0bp to feature; MODIFIER | N | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0322429158 | A -> ACC | LOC_Os03g40330-LOC_Os03g40360 | intergenic_region ; MODIFIER | N | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0322429158 | A -> T | LOC_Os03g40330.1 | upstream_gene_variant ; 4317.0bp to feature; MODIFIER | silent_mutation | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0322429158 | A -> T | LOC_Os03g40360.1 | upstream_gene_variant ; 1080.0bp to feature; MODIFIER | silent_mutation | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| vg0322429158 | A -> T | LOC_Os03g40330-LOC_Os03g40360 | intergenic_region ; MODIFIER | silent_mutation | Average:34.004; most accessible tissue: Zhenshan97 young leaf, score: 53.314 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322429158 | 9.28E-06 | NA | mr1020 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429158 | NA | 1.13E-06 | mr1695 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429158 | 5.14E-07 | NA | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429158 | 2.61E-11 | 1.70E-117 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429158 | NA | 6.34E-35 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429158 | NA | 8.38E-42 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429158 | 4.37E-06 | NA | mr1971 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429158 | NA | 7.41E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322429158 | NA | 6.51E-66 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |