\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322427276:

Variant ID: vg0322427276 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22427276
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGGGGAAAGACACTCGCAAAAGTTGGATATTTGCTGGTGGACACCACACCATTAAAATAATCATGTGAAAGAGAAGAGAGAAATCACGTGAAAGTTCT[A/G]
AAATGCCCTTGGGCCCACATGTCAGATCTGCAACTCTCTATATATATCTCTTTCTCAAGCACATGGGGCCCGCATGCAAACCTCTAGCATCGTTTTCCCT

Reverse complement sequence

AGGGAAAACGATGCTAGAGGTTTGCATGCGGGCCCCATGTGCTTGAGAAAGAGATATATATAGAGAGTTGCAGATCTGACATGTGGGCCCAAGGGCATTT[T/C]
AGAACTTTCACGTGATTTCTCTCTTCTCTTTCACATGATTATTTTAATGGTGTGGTGTCCACCAGCAAATATCCAACTTTTGCGAGTGTCTTTCCCCAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 31.70% 0.44% 0.06% NA
All Indica  2759 98.30% 1.60% 0.07% 0.04% NA
All Japonica  1512 7.60% 91.30% 0.99% 0.07% NA
Aus  269 94.40% 4.80% 0.74% 0.00% NA
Indica I  595 98.50% 1.30% 0.00% 0.17% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.20% 0.70% 0.11% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 1.20% 98.70% 0.00% 0.13% NA
Tropical Japonica  504 6.50% 90.50% 2.98% 0.00% NA
Japonica Intermediate  241 30.30% 69.70% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 54.40% 42.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322427276 A -> DEL N N silent_mutation Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N
vg0322427276 A -> G LOC_Os03g40320.1 upstream_gene_variant ; 3538.0bp to feature; MODIFIER silent_mutation Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N
vg0322427276 A -> G LOC_Os03g40330.1 upstream_gene_variant ; 2435.0bp to feature; MODIFIER silent_mutation Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N
vg0322427276 A -> G LOC_Os03g40360.1 upstream_gene_variant ; 2962.0bp to feature; MODIFIER silent_mutation Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N
vg0322427276 A -> G LOC_Os03g40330-LOC_Os03g40360 intergenic_region ; MODIFIER silent_mutation Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322427276 4.44E-06 NA mr1020 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 NA 8.86E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 9.78E-06 3.54E-07 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 2.25E-06 7.71E-77 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 2.26E-07 6.14E-113 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 NA 2.06E-38 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 NA 3.31E-39 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 NA 1.73E-33 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 4.49E-06 NA mr1971 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 NA 1.84E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 NA 9.30E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 1.00E-06 NA mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 1.64E-07 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322427276 NA 1.57E-67 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251