\
| Variant ID: vg0322427276 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22427276 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 236. )
TTTGGGGAAAGACACTCGCAAAAGTTGGATATTTGCTGGTGGACACCACACCATTAAAATAATCATGTGAAAGAGAAGAGAGAAATCACGTGAAAGTTCT[A/G]
AAATGCCCTTGGGCCCACATGTCAGATCTGCAACTCTCTATATATATCTCTTTCTCAAGCACATGGGGCCCGCATGCAAACCTCTAGCATCGTTTTCCCT
AGGGAAAACGATGCTAGAGGTTTGCATGCGGGCCCCATGTGCTTGAGAAAGAGATATATATAGAGAGTTGCAGATCTGACATGTGGGCCCAAGGGCATTT[T/C]
AGAACTTTCACGTGATTTCTCTCTTCTCTTTCACATGATTATTTTAATGGTGTGGTGTCCACCAGCAAATATCCAACTTTTGCGAGTGTCTTTCCCCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 31.70% | 0.44% | 0.06% | NA |
| All Indica | 2759 | 98.30% | 1.60% | 0.07% | 0.04% | NA |
| All Japonica | 1512 | 7.60% | 91.30% | 0.99% | 0.07% | NA |
| Aus | 269 | 94.40% | 4.80% | 0.74% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.30% | 0.00% | 0.17% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 6.50% | 90.50% | 2.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.30% | 69.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 42.20% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322427276 | A -> DEL | N | N | silent_mutation | Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| vg0322427276 | A -> G | LOC_Os03g40320.1 | upstream_gene_variant ; 3538.0bp to feature; MODIFIER | silent_mutation | Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| vg0322427276 | A -> G | LOC_Os03g40330.1 | upstream_gene_variant ; 2435.0bp to feature; MODIFIER | silent_mutation | Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| vg0322427276 | A -> G | LOC_Os03g40360.1 | upstream_gene_variant ; 2962.0bp to feature; MODIFIER | silent_mutation | Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| vg0322427276 | A -> G | LOC_Os03g40330-LOC_Os03g40360 | intergenic_region ; MODIFIER | silent_mutation | Average:47.265; most accessible tissue: Zhenshan97 young leaf, score: 66.32 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322427276 | 4.44E-06 | NA | mr1020 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | NA | 8.86E-06 | mr1066 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | 9.78E-06 | 3.54E-07 | mr1177 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | 2.25E-06 | 7.71E-77 | mr1718 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | 2.26E-07 | 6.14E-113 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | NA | 2.06E-38 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | NA | 3.31E-39 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | NA | 1.73E-33 | mr1944 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | 4.49E-06 | NA | mr1971 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | NA | 1.84E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | NA | 9.30E-34 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | 1.00E-06 | NA | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | 1.64E-07 | NA | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322427276 | NA | 1.57E-67 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |