\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg0322414125:

Variant ID: vg0322414125 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22414125
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, G: 0.03, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCCAAACTGAAAAGAGACAAACAAACTTGTCAGCATTTTACCATTAATCAATGTTTAGAAGCAGTACTAACAAAAGCACAAGCAACAAAGGGATGCTC[G/T]
ACATACAGTACGAATCAATCACATTATCAAATTCGTAATTTGTTCAGATGTATCTAGTGTCCTGATGGCTCATATATAGTAGAGTTTATATAGATGATAT

Reverse complement sequence

ATATCATCTATATAAACTCTACTATATATGAGCCATCAGGACACTAGATACATCTGAACAAATTACGAATTTGATAATGTGATTGATTCGTACTGTATGT[C/A]
GAGCATCCCTTTGTTGCTTGTGCTTTTGTTAGTACTGCTTCTAAACATTGATTAATGGTAAAATGCTGACAAGTTTGTTTGTCTCTTTTCAGTTTGGGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 31.60% 0.08% 0.11% NA
All Indica  2759 98.30% 1.60% 0.04% 0.11% NA
All Japonica  1512 8.70% 91.30% 0.07% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 98.50% 1.30% 0.00% 0.17% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.30% 0.50% 0.00% 0.11% NA
Indica Intermediate  786 97.50% 2.30% 0.13% 0.13% NA
Temperate Japonica  767 1.20% 98.70% 0.13% 0.00% NA
Tropical Japonica  504 9.70% 90.30% 0.00% 0.00% NA
Japonica Intermediate  241 30.30% 69.70% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 24.00% 0.00% 0.00% NA
Intermediate  90 54.40% 41.10% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322414125 G -> T LOC_Os03g40310.1 intron_variant ; MODIFIER silent_mutation Average:78.587; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N
vg0322414125 G -> DEL N N silent_mutation Average:78.587; most accessible tissue: Zhenshan97 panicle, score: 90.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322414125 NA 8.18E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322414125 2.00E-06 2.00E-06 mr1066 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322414125 5.24E-07 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322414125 NA 8.90E-36 mr1828 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322414125 NA 3.73E-41 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322414125 NA 2.59E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322414125 NA 2.45E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322414125 8.36E-07 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322414125 NA 2.41E-65 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251