\
| Variant ID: vg0322405319 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22405319 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTTACCGTGAATTGTGTCTAGCCCGCTGGTTTAGCCGCAGTCATTGTTGAGTCGTTCCCTCGTTCGTTCGAACGAGGTGTCCTCCGTGGATCGTTCGTT[C/T]
GTCCGTGTTGAGTCGTTCTTTAGTTTAGAGCCGTTCAGAGCCGCCGGTTCCGTTCACCGGTTTCGGTTGATCATTTGGGTGATCTCGTGTCATGTGAAAT
ATTTCACATGACACGAGATCACCCAAATGATCAACCGAAACCGGTGAACGGAACCGGCGGCTCTGAACGGCTCTAAACTAAAGAACGACTCAACACGGAC[G/A]
AACGAACGATCCACGGAGGACACCTCGTTCGAACGAACGAGGGAACGACTCAACAATGACTGCGGCTAAACCAGCGGGCTAGACACAATTCACGGTAAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.60% | 0.70% | 0.63% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 1.30% | 1.09% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 5.50% | 3.19% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 0.30% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322405319 | C -> T | LOC_Os03g40290.1 | upstream_gene_variant ; 4725.0bp to feature; MODIFIER | silent_mutation | Average:54.259; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0322405319 | C -> T | LOC_Os03g40300.1 | downstream_gene_variant ; 2155.0bp to feature; MODIFIER | silent_mutation | Average:54.259; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0322405319 | C -> T | LOC_Os03g40300-LOC_Os03g40310 | intergenic_region ; MODIFIER | silent_mutation | Average:54.259; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322405319 | NA | 6.50E-08 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322405319 | NA | 2.91E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322405319 | 2.45E-06 | 2.96E-07 | mr1669_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322405319 | NA | 2.04E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |