Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322367512:

Variant ID: vg0322367512 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 22367512
Reference Allele: CTGGCTACTT	Alternative Allele: CCTACTT,TTGGCTACTT,C
Primary Allele: CTGGCTACTT	Secondary Allele: TTGGCTACTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGTTCTCAACCAGTTGATCATAGTGATCTCTCGTACATTTGCTTCAAGTGGTCGAGTTACGACTACTGCCTGGTCCTCGACCAGCGATGTAGCGTCTCT[CTGGCTACTT/CCTACTT,TTGGCTACTT,C]
CGACTTTCAGTGGTCGAGTTACGACTACTGCCTGGTTCTCGACCAGCGATGTAGCATCTCTCCGGCTACTTCCACTTTAAGTGGTCGAGTTACGGCTACT

Reverse complement sequence

AGTAGCCGTAACTCGACCACTTAAAGTGGAAGTAGCCGGAGAGATGCTACATCGCTGGTCGAGAACCAGGCAGTAGTCGTAACTCGACCACTGAAAGTCG[AAGTAGCCAG/AAGTAGG,AAGTAGCCAA,G]
AGAGACGCTACATCGCTGGTCGAGGACCAGGCAGTAGTCGTAACTCGACCACTTGAAGCAAATGTACGAGAGATCACTATGATCAACTGGTTGAGAACCA

Allele Frequencies:

Populations	Population Size	Frequency of CTGGCTACTT(primary allele)	Frequency of TTGGCTACTT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.90%	10.00%	11.89%	18.58%	CCTACTT: 0.57%
All Indica	2759	41.10%	15.90%	13.34%	28.67%	CCTACTT: 0.94%
All Japonica	1512	97.70%	0.30%	1.32%	0.60%	CCTACTT: 0.07%
Aus	269	29.00%	9.30%	44.61%	17.10%	NA
Indica I	595	14.30%	41.50%	12.27%	31.76%	CCTACTT: 0.17%
Indica II	465	81.10%	7.30%	4.73%	6.02%	CCTACTT: 0.86%
Indica III	913	36.00%	7.40%	17.20%	37.68%	CCTACTT: 1.64%
Indica Intermediate	786	43.80%	11.50%	14.76%	29.26%	CCTACTT: 0.76%
Temperate Japonica	767	99.00%	0.00%	0.65%	0.39%	NA
Tropical Japonica	504	95.60%	1.00%	2.58%	0.60%	CCTACTT: 0.20%
Japonica Intermediate	241	97.90%	0.00%	0.83%	1.24%	NA
VI/Aromatic	96	32.30%	1.00%	47.92%	18.75%	NA
Intermediate	90	71.10%	4.40%	8.89%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322367512	CTGGCTACTT -> C	LOC_Os03g40240.1	downstream_gene_variant ; 689.0bp to feature; MODIFIER	N	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0322367512	CTGGCTACTT -> C	LOC_Os03g40250.1	downstream_gene_variant ; 1806.0bp to feature; MODIFIER	N	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0322367512	CTGGCTACTT -> C	LOC_Os03g40240-LOC_Os03g40250	intergenic_region ; MODIFIER	N	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0322367512	CTGGCTACTT -> DEL	N	N	silent_mutation	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0322367512	CTGGCTACTT -> CCTACTT	LOC_Os03g40240.1	downstream_gene_variant ; 689.0bp to feature; MODIFIER	silent_mutation	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0322367512	CTGGCTACTT -> CCTACTT	LOC_Os03g40250.1	downstream_gene_variant ; 1806.0bp to feature; MODIFIER	silent_mutation	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0322367512	CTGGCTACTT -> CCTACTT	LOC_Os03g40240-LOC_Os03g40250	intergenic_region ; MODIFIER	silent_mutation	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0322367512	CTGGCTACTT -> TTGGCTACTT	LOC_Os03g40240.1	downstream_gene_variant ; 688.0bp to feature; MODIFIER	silent_mutation	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0322367512	CTGGCTACTT -> TTGGCTACTT	LOC_Os03g40250.1	downstream_gene_variant ; 1807.0bp to feature; MODIFIER	silent_mutation	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0322367512	CTGGCTACTT -> TTGGCTACTT	LOC_Os03g40240-LOC_Os03g40250	intergenic_region ; MODIFIER	silent_mutation	Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322367512	NA	6.17E-24	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322367512	NA	1.92E-11	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322367512	NA	5.69E-09	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	1.99E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	1.83E-15	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	3.59E-16	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	2.22E-15	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	3.89E-06	mr1174	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	2.90E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	2.59E-06	mr1254	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	3.29E-11	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	3.99E-07	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	7.32E-10	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	1.31E-06	mr1399	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	1.00E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	1.48E-14	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	1.87E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	9.21E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	1.82E-14	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	2.55E-11	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	6.34E-06	mr1050_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	4.24E-07	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	4.91E-10	mr1272_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	1.22E-06	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	2.04E-11	mr1607_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	2.12E-16	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	2.13E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512	NA	3.45E-07	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251