\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322367512:

Variant ID: vg0322367512 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 22367512
Reference Allele: CTGGCTACTTAlternative Allele: CCTACTT,TTGGCTACTT,C
Primary Allele: CTGGCTACTTSecondary Allele: TTGGCTACTT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTTCTCAACCAGTTGATCATAGTGATCTCTCGTACATTTGCTTCAAGTGGTCGAGTTACGACTACTGCCTGGTCCTCGACCAGCGATGTAGCGTCTCT[CTGGCTACTT/CCTACTT,TTGGCTACTT,C]
CGACTTTCAGTGGTCGAGTTACGACTACTGCCTGGTTCTCGACCAGCGATGTAGCATCTCTCCGGCTACTTCCACTTTAAGTGGTCGAGTTACGGCTACT

Reverse complement sequence

AGTAGCCGTAACTCGACCACTTAAAGTGGAAGTAGCCGGAGAGATGCTACATCGCTGGTCGAGAACCAGGCAGTAGTCGTAACTCGACCACTGAAAGTCG[AAGTAGCCAG/AAGTAGG,AAGTAGCCAA,G]
AGAGACGCTACATCGCTGGTCGAGGACCAGGCAGTAGTCGTAACTCGACCACTTGAAGCAAATGTACGAGAGATCACTATGATCAACTGGTTGAGAACCA

Allele Frequencies:

Populations Population SizeFrequency of CTGGCTACTT(primary allele) Frequency of TTGGCTACTT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 10.00% 11.89% 18.58% CCTACTT: 0.57%
All Indica  2759 41.10% 15.90% 13.34% 28.67% CCTACTT: 0.94%
All Japonica  1512 97.70% 0.30% 1.32% 0.60% CCTACTT: 0.07%
Aus  269 29.00% 9.30% 44.61% 17.10% NA
Indica I  595 14.30% 41.50% 12.27% 31.76% CCTACTT: 0.17%
Indica II  465 81.10% 7.30% 4.73% 6.02% CCTACTT: 0.86%
Indica III  913 36.00% 7.40% 17.20% 37.68% CCTACTT: 1.64%
Indica Intermediate  786 43.80% 11.50% 14.76% 29.26% CCTACTT: 0.76%
Temperate Japonica  767 99.00% 0.00% 0.65% 0.39% NA
Tropical Japonica  504 95.60% 1.00% 2.58% 0.60% CCTACTT: 0.20%
Japonica Intermediate  241 97.90% 0.00% 0.83% 1.24% NA
VI/Aromatic  96 32.30% 1.00% 47.92% 18.75% NA
Intermediate  90 71.10% 4.40% 8.89% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322367512 CTGGCTACTT -> C LOC_Os03g40240.1 downstream_gene_variant ; 689.0bp to feature; MODIFIER N Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0322367512 CTGGCTACTT -> C LOC_Os03g40250.1 downstream_gene_variant ; 1806.0bp to feature; MODIFIER N Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0322367512 CTGGCTACTT -> C LOC_Os03g40240-LOC_Os03g40250 intergenic_region ; MODIFIER N Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0322367512 CTGGCTACTT -> DEL N N silent_mutation Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0322367512 CTGGCTACTT -> CCTACTT LOC_Os03g40240.1 downstream_gene_variant ; 689.0bp to feature; MODIFIER silent_mutation Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0322367512 CTGGCTACTT -> CCTACTT LOC_Os03g40250.1 downstream_gene_variant ; 1806.0bp to feature; MODIFIER silent_mutation Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0322367512 CTGGCTACTT -> CCTACTT LOC_Os03g40240-LOC_Os03g40250 intergenic_region ; MODIFIER silent_mutation Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0322367512 CTGGCTACTT -> TTGGCTACTT LOC_Os03g40240.1 downstream_gene_variant ; 688.0bp to feature; MODIFIER silent_mutation Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0322367512 CTGGCTACTT -> TTGGCTACTT LOC_Os03g40250.1 downstream_gene_variant ; 1807.0bp to feature; MODIFIER silent_mutation Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N
vg0322367512 CTGGCTACTT -> TTGGCTACTT LOC_Os03g40240-LOC_Os03g40250 intergenic_region ; MODIFIER silent_mutation Average:40.585; most accessible tissue: Zhenshan97 panicle, score: 54.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322367512 NA 6.17E-24 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322367512 NA 1.92E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0322367512 NA 5.69E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 1.99E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 1.83E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 3.59E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 2.22E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 3.89E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 2.90E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 2.59E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 3.29E-11 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 3.99E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 7.32E-10 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 1.31E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 1.00E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 1.48E-14 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 1.87E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 9.21E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 1.82E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 2.55E-11 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 6.34E-06 mr1050_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 4.24E-07 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 4.91E-10 mr1272_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 1.22E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 2.04E-11 mr1607_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 2.12E-16 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 2.13E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322367512 NA 3.45E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251