\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322366031:

Variant ID: vg0322366031 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22366031
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


TTGAGGTTGGCACGGGTATTAAGAAAGTAGGTGAGAATGATTGGAGGAAGTGTGTGATTGGTTGAAAAGAGAAAGTAGGTGAAGAAGAATAGTTGTGATT[G/A]
GTTGAGAGGAGGAGGTAGGTGAAGAAATAGCTTCATTTTGGGACAAGACACTGTGCTAGAAATAGCTACATTTTGGGACGGATGGAGTACCACTGTCCGA

Reverse complement sequence

TCGGACAGTGGTACTCCATCCGTCCCAAAATGTAGCTATTTCTAGCACAGTGTCTTGTCCCAAAATGAAGCTATTTCTTCACCTACCTCCTCCTCTCAAC[C/T]
AATCACAACTATTCTTCTTCACCTACTTTCTCTTTTCAACCAATCACACACTTCCTCCAATCATTCTCACCTACTTTCTTAATACCCGTGCCAACCTCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.00% 0.70% 0.32% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 97.00% 2.10% 0.99% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 94.30% 4.00% 1.69% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322366031 G -> A LOC_Os03g40230.1 upstream_gene_variant ; 4317.0bp to feature; MODIFIER silent_mutation Average:45.77; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0322366031 G -> A LOC_Os03g40250.1 downstream_gene_variant ; 3288.0bp to feature; MODIFIER silent_mutation Average:45.77; most accessible tissue: Minghui63 root, score: 71.259 N N N N
vg0322366031 G -> A LOC_Os03g40240.1 intron_variant ; MODIFIER silent_mutation Average:45.77; most accessible tissue: Minghui63 root, score: 71.259 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322366031 2.74E-06 1.66E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322366031 NA 1.14E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322366031 1.35E-06 4.71E-10 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322366031 NA 2.63E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322366031 NA 4.08E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322366031 2.34E-08 3.81E-10 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322366031 NA 8.03E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322366031 4.35E-07 2.79E-07 mr1559_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322366031 3.17E-09 3.63E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322366031 NA 4.12E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251