\
| Variant ID: vg0322366031 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22366031 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 313. )
TTGAGGTTGGCACGGGTATTAAGAAAGTAGGTGAGAATGATTGGAGGAAGTGTGTGATTGGTTGAAAAGAGAAAGTAGGTGAAGAAGAATAGTTGTGATT[G/A]
GTTGAGAGGAGGAGGTAGGTGAAGAAATAGCTTCATTTTGGGACAAGACACTGTGCTAGAAATAGCTACATTTTGGGACGGATGGAGTACCACTGTCCGA
TCGGACAGTGGTACTCCATCCGTCCCAAAATGTAGCTATTTCTAGCACAGTGTCTTGTCCCAAAATGAAGCTATTTCTTCACCTACCTCCTCCTCTCAAC[C/T]
AATCACAACTATTCTTCTTCACCTACTTTCTCTTTTCAACCAATCACACACTTCCTCCAATCATTCTCACCTACTTTCTTAATACCCGTGCCAACCTCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.00% | 0.70% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 97.00% | 2.10% | 0.99% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 4.00% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322366031 | G -> A | LOC_Os03g40230.1 | upstream_gene_variant ; 4317.0bp to feature; MODIFIER | silent_mutation | Average:45.77; most accessible tissue: Minghui63 root, score: 71.259 | N | N | N | N |
| vg0322366031 | G -> A | LOC_Os03g40250.1 | downstream_gene_variant ; 3288.0bp to feature; MODIFIER | silent_mutation | Average:45.77; most accessible tissue: Minghui63 root, score: 71.259 | N | N | N | N |
| vg0322366031 | G -> A | LOC_Os03g40240.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.77; most accessible tissue: Minghui63 root, score: 71.259 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322366031 | 2.74E-06 | 1.66E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322366031 | NA | 1.14E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322366031 | 1.35E-06 | 4.71E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322366031 | NA | 2.63E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322366031 | NA | 4.08E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322366031 | 2.34E-08 | 3.81E-10 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322366031 | NA | 8.03E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322366031 | 4.35E-07 | 2.79E-07 | mr1559_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322366031 | 3.17E-09 | 3.63E-12 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322366031 | NA | 4.12E-06 | mr1703_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |