Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322365483:

Variant ID: vg0322365483 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 22365483
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGGATGTAGGGCTATTACCTGACTGCTCAGGGACCCGAACCTGTATAAAAATCCCTGTCCCCATCTCTTTTACCTCAGTCTCGCATATATCCTAACAC[T/C]
AACGATCCCCATATTGTCCAAATACCGTAGTCGAGACATCAAACGTCGACAGTGGTGCGCCAGGTAGGGGGATTTTGGTGCTCTAGGATTTCGACGAGAT

Reverse complement sequence

ATCTCGTCGAAATCCTAGAGCACCAAAATCCCCCTACCTGGCGCACCACTGTCGACGTTTGATGTCTCGACTACGGTATTTGGACAATATGGGGATCGTT[A/G]
GTGTTAGGATATATGCGAGACTGAGGTAAAAGAGATGGGGACAGGGATTTTTATACAGGTTCGGGTCCCTGAGCAGTCAGGTAATAGCCCTACATCCTGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.40%	31.60%	0.00%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.00%	0.00%	NA
All Japonica	1512	8.90%	91.10%	0.00%	0.00%	NA
Aus	269	95.50%	4.50%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	1.20%	98.80%	0.00%	0.00%	NA
Tropical Japonica	504	9.70%	90.30%	0.00%	0.00%	NA
Japonica Intermediate	241	32.00%	68.00%	0.00%	0.00%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0322365483	T -> C	LOC_Os03g40230.1	upstream_gene_variant ; 3769.0bp to feature; MODIFIER	silent_mutation	Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0322365483	T -> C	LOC_Os03g40240.1	upstream_gene_variant ; 249.0bp to feature; MODIFIER	silent_mutation	Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0322365483	T -> C	LOC_Os03g40250.1	downstream_gene_variant ; 3836.0bp to feature; MODIFIER	silent_mutation	Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N
vg0322365483	T -> C	LOC_Os03g40230-LOC_Os03g40240	intergenic_region ; MODIFIER	silent_mutation	Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0322365483	NA	5.03E-06	mr1522	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	7.07E-08	NA	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	NA	6.25E-07	mr1807	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	NA	1.15E-33	mr1944	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	4.14E-06	4.14E-06	mr1193_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	NA	8.77E-24	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	NA	1.23E-11	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	NA	1.05E-35	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	NA	1.40E-24	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	5.59E-06	NA	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483	NA	4.62E-66	mr1828_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251