\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0322365483:

Variant ID: vg0322365483 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 22365483
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGGATGTAGGGCTATTACCTGACTGCTCAGGGACCCGAACCTGTATAAAAATCCCTGTCCCCATCTCTTTTACCTCAGTCTCGCATATATCCTAACAC[T/C]
AACGATCCCCATATTGTCCAAATACCGTAGTCGAGACATCAAACGTCGACAGTGGTGCGCCAGGTAGGGGGATTTTGGTGCTCTAGGATTTCGACGAGAT

Reverse complement sequence

ATCTCGTCGAAATCCTAGAGCACCAAAATCCCCCTACCTGGCGCACCACTGTCGACGTTTGATGTCTCGACTACGGTATTTGGACAATATGGGGATCGTT[A/G]
GTGTTAGGATATATGCGAGACTGAGGTAAAAGAGATGGGGACAGGGATTTTTATACAGGTTCGGGTCCCTGAGCAGTCAGGTAATAGCCCTACATCCTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.40% 31.60% 0.00% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 8.90% 91.10% 0.00% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 9.70% 90.30% 0.00% 0.00% NA
Japonica Intermediate  241 32.00% 68.00% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0322365483 T -> C LOC_Os03g40230.1 upstream_gene_variant ; 3769.0bp to feature; MODIFIER silent_mutation Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0322365483 T -> C LOC_Os03g40240.1 upstream_gene_variant ; 249.0bp to feature; MODIFIER silent_mutation Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0322365483 T -> C LOC_Os03g40250.1 downstream_gene_variant ; 3836.0bp to feature; MODIFIER silent_mutation Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N
vg0322365483 T -> C LOC_Os03g40230-LOC_Os03g40240 intergenic_region ; MODIFIER silent_mutation Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0322365483 NA 5.03E-06 mr1522 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 7.07E-08 NA mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 NA 6.25E-07 mr1807 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 NA 1.15E-33 mr1944 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 4.14E-06 4.14E-06 mr1193_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 NA 8.77E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 NA 1.23E-11 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 NA 1.05E-35 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 NA 1.40E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 5.59E-06 NA mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0322365483 NA 4.62E-66 mr1828_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251