\
| Variant ID: vg0322365483 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 22365483 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 259. )
ACAGGATGTAGGGCTATTACCTGACTGCTCAGGGACCCGAACCTGTATAAAAATCCCTGTCCCCATCTCTTTTACCTCAGTCTCGCATATATCCTAACAC[T/C]
AACGATCCCCATATTGTCCAAATACCGTAGTCGAGACATCAAACGTCGACAGTGGTGCGCCAGGTAGGGGGATTTTGGTGCTCTAGGATTTCGACGAGAT
ATCTCGTCGAAATCCTAGAGCACCAAAATCCCCCTACCTGGCGCACCACTGTCGACGTTTGATGTCTCGACTACGGTATTTGGACAATATGGGGATCGTT[A/G]
GTGTTAGGATATATGCGAGACTGAGGTAAAAGAGATGGGGACAGGGATTTTTATACAGGTTCGGGTCCCTGAGCAGTCAGGTAATAGCCCTACATCCTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.40% | 31.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 8.90% | 91.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.70% | 90.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 32.00% | 68.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0322365483 | T -> C | LOC_Os03g40230.1 | upstream_gene_variant ; 3769.0bp to feature; MODIFIER | silent_mutation | Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| vg0322365483 | T -> C | LOC_Os03g40240.1 | upstream_gene_variant ; 249.0bp to feature; MODIFIER | silent_mutation | Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| vg0322365483 | T -> C | LOC_Os03g40250.1 | downstream_gene_variant ; 3836.0bp to feature; MODIFIER | silent_mutation | Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| vg0322365483 | T -> C | LOC_Os03g40230-LOC_Os03g40240 | intergenic_region ; MODIFIER | silent_mutation | Average:56.031; most accessible tissue: Zhenshan97 flag leaf, score: 69.582 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0322365483 | NA | 5.03E-06 | mr1522 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | 7.07E-08 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | NA | 6.25E-07 | mr1807 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | NA | 1.15E-33 | mr1944 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | 4.14E-06 | 4.14E-06 | mr1193_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | NA | 8.77E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | NA | 1.23E-11 | mr1377_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | NA | 1.05E-35 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | NA | 1.40E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | 5.59E-06 | NA | mr1718_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0322365483 | NA | 4.62E-66 | mr1828_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |